Difference between revisions of "Part:BBa K3254000"
Line 3: Line 3:
 
<partinfo>BBa_K3254000 short</partinfo>
 
<partinfo>BBa_K3254000 short</partinfo>
  
−
This part is an improvement for the part [[Part:BBa_K2243031|BBa_K2243031]]. It can be placed between a promoter and a translational unit part and work as a normally open (NO) switch for the downstreamed gene, and switch to ON state by flipping the unidirectional terminator ECK120034435 between the att sites when it reacted with phiC31 integrase [[Part:BBa_K1039012|BBa_K1039012]]. In this improved version, two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it flipped.
+
This part is an improvement for the part [[Part:BBa_K2243031|BBa_K2243031]]. It can be placed between a promoter and a translational unit part and works as a normally open (NO) switch for the downstreamed gene, and switch to ON state by flipping the unidirectional terminator ECK120034435 between the att sites when it reacted with phiC31 integrase [[Part:BBa_K1039012|BBa_K1039012]]. In this improved version, two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it flipped.
 +
 
 +
=Usage and Biology=
 +
==Visual Result as a Normally Closed Switch==
 +
*We conducted a simple test to see if our design met the expection.
 +
 
 +
===Experimental Setup===
 +
*Genetic design principle of the experimental group is described on the page of [[Part:BBa_K3254010|BBa_K3254010]].
 +
*A P15A-AmpR plasmid was co-transfered into the E.coli DH5α host cell with the reporter plasmid containing this part as the negative control.
 +
*Single colonies were selected from the experimental LB-agar plate and negative control LB-agar plate, then inoculated into EP tubes with 500 μL M9 supplemented medium containing 500 μM IPTG for overnight growth at 37 °C and 200 rpm.
 +
*Tubes were centrifuged at 10000g for 1 min. Then observed the GFP fluorescence of the cell precipitations under blue light.
 +
 
 +
===Results===
 +
*IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respctively.
 +
*We observed the GFP fluorescence from the experimental tube as expected.
 +
 
 +
[[File:T--GENAS_China--primary_screening.png]]
 +
 
 +
==Quantitative Characterizaion of the Normally Open Switch==
 +
 
 +
===Experimental Setup===
 +
*Bacteria harboring the circuits (see the top part of the result image) first inoculated from single colonies into a flat-bottom 96-well plate for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium with 500 μM IPTG inducer and growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, 3-μL samples each culture were transferred to a new 96-well plate containing 200 μL per well of PBS supplemented with 2 mg/mL kanamycin.
 +
*The fluorescence distribution of each sample was assayed using a flow cytometry. The arithmetical mean of each sample was determined using FlowJo software.
 +
*The principle of data processing is shown on the result image.
 +
 
 +
===Results===
 +
*IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respctively.
 +
*Compared to other parts, this part performed well.
 +
 
 +
[[File:T--GENAS_China--primary_quantitative_characterizaion.png]]
 +
 
 +
==Visual Results as a Normally Closed Switch and Toggle Switch==
 +
*We inserted an [[Part:BBa_K592009|amilCP]] translational unit between the two BsaI sites.
 +
*Other experiment setup were the same with "Visual Result as a Normally Closed Switch".
 +
 
 +
===Results===
 +
*The normally open switch function well though a light blue color can be observed from the cell precipitations which might due to the incomplete diluted amilCP protein or an unexpected backward promoter.
 +
*At the same time, the downstreamed GFP wasn't expression well which might due to the potential attenuation signal in the reversed amilCP sequence.
 +
[[File:T--GENAS_China--NC_switch.png]]
 +
 
 +
==Orthogonality Characterization==
 +
 
 +
===Genetic Design===
 +
*The composition and principle of the experimental system are indicated below.
 +
 
 +
[[File:T--GENAS_China--Flip_with_backbone.PNG|200px|thumb|left| ]]
 +
 
 +
===Experimental Setup===
 +
The reporter plasmid contained this part were co-transferred into E.coli DH5α host with 6 integrase generator plasmids.
 +
Then single colonies were inoculated into M9 supplemented medium for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium with 500 μM IPTG inducer and growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, The cultures were sampled for genotype PCR testing.
 +
The principle of genotype identification was shown on the right of results image.
 +
 
 +
===Results===
 +
*IBR-C35 was the plasmid containing this part.
 +
*The result indicates that this part can only be recombined by phiC31 integrase.
 +
*The sequences after recombination are GATCAGCTCCGCGGGCAAGACCGTGCTCTTACCCAGTTGGGCGGGA (attL) and tgcgGGTGCCAGGGCGTGCCCTTGAGTTCTCTCAGTTGGGGG (attR).
 +
 
 +
[[File:T--GENAS_China--orthogonality_test.png]]
 +
 
 +
 
 +
 
 +
 
  
−
<!-- Add more about the biology of this part here
 
−
===Usage and Biology===
 
  
−
<!-- -->
 
 
<span class='h3bb'>Sequence and Features</span>
 
<span class='h3bb'>Sequence and Features</span>
 
<partinfo>BBa_K3254000 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K3254000 SequenceAndFeatures</partinfo>

Revision as of 11:39, 20 October 2019


phiC31attB-BsaI sites-terminator-phiC31attP(r)

This part is an improvement for the part BBa_K2243031. It can be placed between a promoter and a translational unit part and works as a normally open (NO) switch for the downstreamed gene, and switch to ON state by flipping the unidirectional terminator ECK120034435 between the att sites when it reacted with phiC31 integrase BBa_K1039012. In this improved version, two BsaI restriction site were added between attB site and terminator. As a result, it can work as a normally closed (NC) switch for the gene which was inserted between the two BsaI site and switch to OFF state when it flipped.

Usage and Biology

Visual Result as a Normally Closed Switch

  • We conducted a simple test to see if our design met the expection.

Experimental Setup

  • Genetic design principle of the experimental group is described on the page of BBa_K3254010.
  • A P15A-AmpR plasmid was co-transfered into the E.coli DH5α host cell with the reporter plasmid containing this part as the negative control.
  • Single colonies were selected from the experimental LB-agar plate and negative control LB-agar plate, then inoculated into EP tubes with 500 μL M9 supplemented medium containing 500 μM IPTG for overnight growth at 37 °C and 200 rpm.
  • Tubes were centrifuged at 10000g for 1 min. Then observed the GFP fluorescence of the cell precipitations under blue light.

Results

  • IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respctively.
  • We observed the GFP fluorescence from the experimental tube as expected.

T--GENAS China--primary screening.png

Quantitative Characterizaion of the Normally Open Switch

Experimental Setup

  • Bacteria harboring the circuits (see the top part of the result image) first inoculated from single colonies into a flat-bottom 96-well plate for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium with 500 μM IPTG inducer and growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, 3-μL samples each culture were transferred to a new 96-well plate containing 200 μL per well of PBS supplemented with 2 mg/mL kanamycin.
  • The fluorescence distribution of each sample was assayed using a flow cytometry. The arithmetical mean of each sample was determined using FlowJo software.
  • The principle of data processing is shown on the result image.

Results

  • IBR-C35/F55/S37/E21/T25/G22 indicate the experimental systems for phiC31/Int5/Int7/Int8/Int10/TG1 respctively.
  • Compared to other parts, this part performed well.

T--GENAS China--primary quantitative characterizaion.png

Visual Results as a Normally Closed Switch and Toggle Switch

  • We inserted an amilCP translational unit between the two BsaI sites.
  • Other experiment setup were the same with "Visual Result as a Normally Closed Switch".

Results

  • The normally open switch function well though a light blue color can be observed from the cell precipitations which might due to the incomplete diluted amilCP protein or an unexpected backward promoter.
  • At the same time, the downstreamed GFP wasn't expression well which might due to the potential attenuation signal in the reversed amilCP sequence.

T--GENAS China--NC switch.png

Orthogonality Characterization

Genetic Design

  • The composition and principle of the experimental system are indicated below.
T--GENAS China--Flip with backbone.PNG

Experimental Setup

The reporter plasmid contained this part were co-transferred into E.coli DH5α host with 6 integrase generator plasmids. Then single colonies were inoculated into M9 supplemented medium for overnight growth. Then, the cell cultures were diluted 1000-fold with M9 supplemented medium with 500 μM IPTG inducer and growth for another 20 hours. All incubations were carried out using a Digital Thermostatic Shaker maintained at 37 °C and 1000 rpm, using flat-bottom 96-well plates sealed with sealing film. Finally, The cultures were sampled for genotype PCR testing. The principle of genotype identification was shown on the right of results image.

Results

  • IBR-C35 was the plasmid containing this part.
  • The result indicates that this part can only be recombined by phiC31 integrase.
  • The sequences after recombination are GATCAGCTCCGCGGGCAAGACCGTGCTCTTACCCAGTTGGGCGGGA (attL) and tgcgGGTGCCAGGGCGTGCCCTTGAGTTCTCTCAGTTGGGGG (attR).

T--GENAS China--orthogonality test.png




Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 59
    Illegal BsaI.rc site found at 47