Difference between revisions of "Part:BBa K3192026:Design"
Line 9: Line 9:
  
 
The recognition sequence ggtctc is used for recognition of the BsaI restriction enzyme used for Golden Gate assembly. When cloning multiple inserts into a vector using Golden Gate assembly, it is recommended to add a 5 base pair recognition sequence following the restriction site, before you insert, that is complementary to the adjacent insert of interest to increase the specificity of the reaction.
 
The recognition sequence ggtctc is used for recognition of the BsaI restriction enzyme used for Golden Gate assembly. When cloning multiple inserts into a vector using Golden Gate assembly, it is recommended to add a 5 base pair recognition sequence following the restriction site, before you insert, that is complementary to the adjacent insert of interest to increase the specificity of the reaction.
−
 
−
For example, for this sequence, ggtctcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctc
 
  
 
For many golden gate assembly mastermixes the addition of a 5 base pair recognition sequence is recommended. This sequence should be complementary on each end with the adjacent overlapping sequence. Ensure that this sequence your team chooses to insert is not another restriction enzyme site. Below is an example of the sequence with the 5 unique sites inserted.  
 
For many golden gate assembly mastermixes the addition of a 5 base pair recognition sequence is recommended. This sequence should be complementary on each end with the adjacent overlapping sequence. Ensure that this sequence your team chooses to insert is not another restriction enzyme site. Below is an example of the sequence with the 5 unique sites inserted.  

Revision as of 21:13, 19 October 2019


Double terminator designed for golden gate assembly


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 1
    Illegal BsaI site found at 136


Design Notes

The recognition sequence ggtctc is used for recognition of the BsaI restriction enzyme used for Golden Gate assembly. When cloning multiple inserts into a vector using Golden Gate assembly, it is recommended to add a 5 base pair recognition sequence following the restriction site, before you insert, that is complementary to the adjacent insert of interest to increase the specificity of the reaction.

For many golden gate assembly mastermixes the addition of a 5 base pair recognition sequence is recommended. This sequence should be complementary on each end with the adjacent overlapping sequence. Ensure that this sequence your team chooses to insert is not another restriction enzyme site. Below is an example of the sequence with the 5 unique sites inserted.

ggtctcNNNNNccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataNNNNNggtctc


Source

Escherichia coli

References