Difference between revisions of "Part:BBa K3192026:Design"
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
−
This terminator is a redesign of the double terminator BBa_B0015, a very well characterized iGEM terminator. BasI restriction sites were added to each terminator end to increase the ease of requesting this part for the intended use of golden gate assembly.
 
  
−
The 2019 Virginia iGEM team utilized Golden Gate Assembly for their project, and are aware it is a popular assembly method for many other iGEM teams. Through the addition of restriction sites compatible for Golden Gate, Virginia IGEM hoped to increase the ease of designing constructs for Golden Gate. Team planning on using this part and assembling using Golden Gate can now do so with more ease. Please see the design page for additional design notes on how to further optimize this BioBrick for Golden Gate Assembly.  
+
The recognition sequence ggtctc is used for recognition of the BsaI restriction enzyme used for Golden Gate assembly. When cloning multiple inserts into a vector using Golden Gate assembly, it is recommended to add a 5 base pair recognition sequence following the restriction site, before you insert, that is complementary to the adjacent insert of interest to increase the specificity of the reaction.
 +
 
 +
For example, for this sequence, ggtctcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctc
 +
 
 +
For many golden gate assembly mastermixes the addition of a 5 base pair recognition sequence is recommended. This sequence should be complementary on each end with the adjacent overlapping sequence. Ensure that this sequence your team chooses to insert is not another restriction enzyme site. Below is an example of the sequence with the 5 unique sites inserted.  
 +
 
 +
ggtctcNNNNNccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataNNNNNggtctc
  
  

Revision as of 21:11, 19 October 2019


Double terminator designed for golden gate assembly


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 1
    Illegal BsaI site found at 136


Design Notes

The recognition sequence ggtctc is used for recognition of the BsaI restriction enzyme used for Golden Gate assembly. When cloning multiple inserts into a vector using Golden Gate assembly, it is recommended to add a 5 base pair recognition sequence following the restriction site, before you insert, that is complementary to the adjacent insert of interest to increase the specificity of the reaction.

For example, for this sequence, ggtctcccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataggtctc

For many golden gate assembly mastermixes the addition of a 5 base pair recognition sequence is recommended. This sequence should be complementary on each end with the adjacent overlapping sequence. Ensure that this sequence your team chooses to insert is not another restriction enzyme site. Below is an example of the sequence with the 5 unique sites inserted.

ggtctcNNNNNccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttataNNNNNggtctc


Source

Escherichia coli

References