Difference between revisions of "Part:BBa K2983021"

Revision as of 13:59, 19 October 2019 (view source) Anthor91 (Talk | contribs) ← Older edit		Revision as of 14:54, 19 October 2019 (view source) Anthor91 (Talk | contribs) (→‎Usage and Biology) Newer edit →
Line 6:		Line 6:
	===Usage and Biology===		===Usage and Biology===
		+	[[File:T--Evry Paris-Saclay--Loop-Sites.png|300px|thumb| Figure 1. BsaI and SapI restriction sites (adapted from [1])]] The Loop Type IIS cloning sites (triangles in figures 1 and 2) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figures 1 and 2).
		+
		+
		+
		+
		+
		+
		+
		+
		+
		+
		+
		+
		+	A total of 50 combinations are theoretically possible and this part is one of them: the loop Alpha-A (Figure 2).
		+
		+
−	The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the loop Omega-C is as fellow : GCTCTTCAGGTAAATGTGAGACC
−
	[[File:T--Evry Paris-Saclay--Loop Omega-C.png|300px|thumb|left| Figure 1:Loop Omega-C structure]]		[[File:T--Evry Paris-Saclay--Loop Omega-C.png|300px|thumb|left| Figure 1:Loop Omega-C structure]]
Line 20:		Line 34:
	Orange circle: overhang formed by BasI  after cutting (AATG)		Orange circle: overhang formed by BasI  after cutting (AATG)
		+
		+
		+
		+	This part was used to define the Loop assembly system dedicated to the oleaginous yeast ''Yarrowia lipolytica'' (for details visit https://2019.igem.org/Team:Evry_Paris-Saclay/Design)
		+
		+	===References===
		+
		+	[1] Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.

---

Revision as of 14:54, 19 October 2019

Loop Omega-C

This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites.

Usage and Biology

The Loop Type IIS cloning sites (triangles in figures 1 and 2) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figures 1 and 2).

A total of 50 combinations are theoretically possible and this part is one of them: the loop Alpha-A (Figure 2).

Blue triangle: SapI fixation site (GCTCTTC)

Red triangle : BsaI fixation site (GAGACC)

grey circle : overhang formed by SapI after cutting (GGT)

Orange circle: overhang formed by BasI after cutting (AATG)

This part was used to define the Loop assembly system dedicated to the oleaginous yeast Yarrowia lipolytica (for details visit https://2019.igem.org/Team:Evry_Paris-Saclay/Design)

References

[1] Pollak B, Cerda A, Delmans M, Álamos S, Moyano T, West A, Gutiérrez RA, Patron NJ, Federici F, Haseloff J. Loop assembly: a simple and open system for recursive fabrication of DNA circuits. New Phytol (2019) 222, 628-640.

Sequence and Features