Difference between revisions of "Part:BBa K2983011"
Line 4: | Line 4: | ||
This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites. | This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites. | ||
+ | |||
+ | ===Usage and Biology=== | ||
+ | |||
+ | The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the loop Alpha is as fellow : GGTCTCACGCTAGCATGAAGAGC | ||
+ | |||
+ | [[File:T--Evry Paris-Saclay--Loop F-Beta.png|300px|thumb|left| Figure1: Loop F-Beta structure]] | ||
+ | |||
+ | |||
+ | Blue triangle: SapI fixation site (GAAGAGC) | ||
+ | |||
+ | Red triangle : BsaI fixation site (GGTCTC) | ||
+ | |||
+ | Blue circle : overhang formed by SapI after cutting (GCA) | ||
+ | |||
+ | Yellow circle: overhang formed by BasI after cutting (CGCT) | ||
+ | |||
+ | |||
+ | |||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Revision as of 13:19, 19 October 2019
Loop F-Beta
This part is a Loop Type IIS Golden gate adapter that contains a BsaI and a SapI restriction sites.
Usage and Biology
The Loop Type IIS cloning sites (triangles in figure 1) are a combination of BsaI and SapI restriction sites each with different cutting sites that generate well defined overhangs (circles in Figure 1).The sequence of the loop Alpha is as fellow : GGTCTCACGCTAGCATGAAGAGC
Blue triangle: SapI fixation site (GAAGAGC)
Red triangle : BsaI fixation site (GGTCTC)
Blue circle : overhang formed by SapI after cutting (GCA)
Yellow circle: overhang formed by BasI after cutting (CGCT)
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 9
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 1
Illegal SapI.rc site found at 17