Difference between revisions of "Part:BBa K431007"

(ShanghaiFLS_China 2019 characterization)
(ShanghaiFLS_China 2019 characterization)
Line 5: Line 5:
 
==ShanghaiFLS_China 2019 characterization==
 
==ShanghaiFLS_China 2019 characterization==
 
'''Methanol induction of the AOX1 promoter'''
 
'''Methanol induction of the AOX1 promoter'''
 +
 
The AOX1 (alcohol oxidase 1, PAS_chr4_0821) promoter used in this plasmid, homogenous to Pichia pastoris, is a very strong promoter that is tightly regulated by the carbon source present in the media: it is strongly inhibited by glucose and glycerol, but significantly induced when methanol is present as the only carbon source. This characteristic allows P. pastoris to be a very preferable strain for regulated bioreactor production.
 
The AOX1 (alcohol oxidase 1, PAS_chr4_0821) promoter used in this plasmid, homogenous to Pichia pastoris, is a very strong promoter that is tightly regulated by the carbon source present in the media: it is strongly inhibited by glucose and glycerol, but significantly induced when methanol is present as the only carbon source. This characteristic allows P. pastoris to be a very preferable strain for regulated bioreactor production.
  
Line 30: Line 31:
 
TTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACG
 
TTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACG
 
ACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACG
 
ACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACG
 +
 +
'''Experimental Data Demonstrating pAOX1 activity in methanol media'''
 +
In our experiment, we integrated pAOX1-GFP (yEGFP3 expressed by the AOX1 promoter (pAOX1), BBa_K3239007) into wild type Pichia pastoris GS115 to reflect the expression level of the AOX1 protein in P. pastoris GS115 (the original pAOX1-AOX1 is left intact after the integration, and both yEGFP3 and AOX1 are expressed by pAOX1 regulated in the same way). Figure 1 illustrates the modified P. pastoris GS115 construct after pAOX1-GFP integration.
 +
 +
[[File:pAOX1-GFP.png|400px|center|thumb|Figure 1. Illustration of the pAOX1-GFP construct]]
 +
 +
'''Methods'''
 +
*The following data were acquired after 108h 50mL YNM (1.34% yeat nitrogenous base with 0.5% methanol, 50µg/mL histidine and 40µg/mL biotin) incubation, sampled every 12h. The starting concentration was 1 OD600.
 +
*0.5%Methanol was added to the media every 24 hours to maintain the methanol concentration.
 +
*A short-term methanol induction experiment was performed after the 108h incubation to characterize the instant response to methanol induction after the yeast cells are accustomed to methanol media, hence indicating the overall induction activity of the construct. The yeast cells were collected, rinsed and stored at 4˚C overnight to allow GFP to fully degrade. The strains were then incubated in higher-concentration 50mL YNM media (1.34% yeat nitrogenous base with 0.75% methanol, 50µg/mL histidine and 40µg/mL biotin) for 12 hours and sampled every 2 hours. The starting concentration was 3 OD600.
 +
*Three parallels were performed for each strain.
 +
 +
*We used a Biotek Synergy 2 plate reader to measure the GFP mean fluorescence intensities and the OD600 absorbance of our samples.
 +
*Methanol concentration measurements were performed with a Shenzhen Sieman M100 Biosensors Analyzer.
 +
 +
[[File:Yeast Concentration(108h)AOX1-GFP.png|200px|thumb|Figure 1. pAOX1-GFP cell concentration curve during the 108h incubation period]]
 +
[[File:Measured unit cell GFP(108h)AOX1-GFP.png|200px|thumb|Figure 2. pAOX1-GFP measured unit cell GFP production curve during the 108h incubation period]]
 +
[[File:Aggregate unit cell GFP(108h)AOX1-GFP.png|200px|thumb|Figure 3. pAOX1-GFP aggregate unit cell GFP production curve during the 108h incubation period]]
 +
[[File:Total GFP production(108h)AOX1-GFP.png|200px|thumb|Figure 4. pAOX1-GFP total GFP production curve during the 108h incubation period]]
 +
[[File:Total methanol consumption(108h)AOX1-GFP.png|200px|thumb|Figure 5. pAOX1-GFP total methanol consumption during the 108h incubation period]]
 +
[[File:Total GFP production per gram methanol(108h)AOX1-GFP.png|200px|thumb|Figure 6. pAOX1-GFP total GFP production per gram methanol during the 108h incubation period]]
 +
[[File:Measured unit cell GFP(quick induction)pAOX1-GFP.png|200px|thumb|Figure 6. pAOX1-GFP measured unit cell GFP production curve during the short-term methanol induction period]]
 +
 +
 +
'''Data'''
 +
*OD600 is used as an indicator of yeast concentration in the experiment.
 +
*Measured unit cell GFP production is the ratio of the GFP mean fluorescence intensities to the 0D600 absorbance measured by the plate reader. It shall serve as an indicator of the expression level of GFP at the sampled time point.
 +
*Aggregate unit cell GFP production is the calculated total unit cell GFP fluorescence intensity. It accounts for the GFP that has degraded over the incubation period to more accurately reflect the aggregate production rate.
 +
*Total GFP production is the product of the yeast concentration and the aggregate unit cell GFP. It reflects the total GFP production of the reaction system of the strain.
 +
*Total GFP production per gram methanol is the ratio of the total GFP production to the total methanol consumption. It reflects the overall conversion rate of methanol to the product.
 +
 +
 +
*For teams wishing to compare their data to ours, we've provided our data along with our plate reader calibration data in our wiki. Feel free to give it a check!
  
 
==Reference==
 
==Reference==

Revision as of 16:35, 16 October 2019

Alcohol Oxidase 1 promoter

Pichia pastoris initially gained attention as an expression system after recognition of its methylotrophic capabilities and the high levels of alcohol oxidase(AOX) present when induced by methanol. By isolating the promoter (pAOX1 )responsible for AOX production, this system can be utilized to obtain high yields of heterologous protein. The promoter provides not only high expression but very tight regulation as well. Vectors providing protein expression under the control of pAOX1 are the primary system used for P. pastoris

ShanghaiFLS_China 2019 characterization

Methanol induction of the AOX1 promoter

The AOX1 (alcohol oxidase 1, PAS_chr4_0821) promoter used in this plasmid, homogenous to Pichia pastoris, is a very strong promoter that is tightly regulated by the carbon source present in the media: it is strongly inhibited by glucose and glycerol, but significantly induced when methanol is present as the only carbon source. This characteristic allows P. pastoris to be a very preferable strain for regulated bioreactor production.

The activity of the AOX1 promoter is characterized by GFP fluorescence and is compared to that of the GAP promoter, a strong constitutive promoter in P. pastoris. Specifically, GFP is expressed by either of the promoters and these constructed strains of P. pastoris are incubated for 12 hours in YNB medium (0.67% yeast nitrogenous base without amino acids) and 50 mg/mL histidine supplemented with 1% glucose (YND), 1% glycerol (YNG), or 0.5% methanol(YNM). The geometric mean of the fluorescence of the GFP expressed is then measured by an enzyme-labeled instrument (Synergy 2 by BioTek Instruments) and normalized to unit cell concentrations (in terms of arbitrary units as represented by OD600 measured by the enzyme-labeled instrument).

As illustrated by figure 1, the activity of the GAP promoter remains largely unchanged relative to the carbon source in the media. The activity of the AOX1 promoter, however, is minimal in glycerol and glucose media, yet very significant in methanol media.

Figure 1. evaluation of the activity of the AOX1 Promoter via a reporter gene (GFP) expression assay in the wild type P.pastoris strain in glucose (D), glycerol (G) and methanol (M) media.

In wild type P. pastoris, alcohol oxidase 1 allows the methylotrophic yeast to metabolize methanol. The regulation of the AOX1 promoter indicates high specificity in the expression of alcohol oxidase 1 and therefore makes P. pastoris a very attractive candidate for regulated fermentation on an industrial scale, especially if the production of a certain chemical needs to be precisely controlled: the protein expressed by the AOX1 promoter can be relatively simply controlled by shifting the carbon source present in the media.

This experiment is published in Wang et al.,2016.

Complete AOX1 promoter sequence:

GATCTAACATCCAAAGACGAAAGGTTGAATGAAACCTTTTTGCCATCCGACATCCACAGGTCCATTCTCACACATAAGTG CCAAACGCAACAGGAGGGGATACACTAGCAGCAGACCGTTGCAAACGCAGGACCTCCACTCCTCTTCTCCTCAACACC CACTTTTGCCATCGAAAAACCAGCCCAGTTATTGGGCTTGATTGGAGCTCGCTCATTCCAATTCCTTCTATTAGGCTACTA ACACCATGACTTTATTAGCCTGTCTATCCTGGCCCCCCTGGCGAGGTTCATGTTTGTTTATTTCCGAATGCAACAAGCTCC GCATTACACCCGAACATCACTCCAGATGAGGGCTTTCTGAGTGTGGGGTCAAATAGTTTCATGTTCCCCAAATGGCCCAAA ACTGACAGTTTAAACGCTGTCTTGGAACCTAATATGACAAAAGCGTGATCTCATCCAAGATGAACTAAGTTTGGTTCGTTGA AATGCTAACGGCCAGTTGGTCAAAAAGAAACTTCCAAAAGTCGGCATACCGTTTGTCTTGTTTGGTATTGATTGACGAATGC TCAAAAATAATCTCATTAATGCTTAGCGCAGTCTCTCTATCGCTTCTGAACCCCGGTGCACCTGTGCCGAAACGCAAATGGG GAAACACCCGCTTTTTGGATGATTATGCATTGTCTCCACATTGTATGCTTCCAAGATTCTGGTGGGAATACTGCTGATAGCCT AACGTTCATGATCAAAATTTAACTGTTCTAACCCCTACTTGACAGCAATATATAAACAGAAGGAAGCTGCCCTGTCTTAAACC TTTTTTTTTATCATCATTATTAGCTTACTTTCATAATTGCGACTGGTTCCAATTGACAAGCTTTTGATTTTAACGACTTTTAACG ACAACTTGAGAAGATCAAAAAACAACTAATTATTCGAAACG

Experimental Data Demonstrating pAOX1 activity in methanol media In our experiment, we integrated pAOX1-GFP (yEGFP3 expressed by the AOX1 promoter (pAOX1), BBa_K3239007) into wild type Pichia pastoris GS115 to reflect the expression level of the AOX1 protein in P. pastoris GS115 (the original pAOX1-AOX1 is left intact after the integration, and both yEGFP3 and AOX1 are expressed by pAOX1 regulated in the same way). Figure 1 illustrates the modified P. pastoris GS115 construct after pAOX1-GFP integration.

Figure 1. Illustration of the pAOX1-GFP construct

Methods

  • The following data were acquired after 108h 50mL YNM (1.34% yeat nitrogenous base with 0.5% methanol, 50µg/mL histidine and 40µg/mL biotin) incubation, sampled every 12h. The starting concentration was 1 OD600.
  • 0.5%Methanol was added to the media every 24 hours to maintain the methanol concentration.
  • A short-term methanol induction experiment was performed after the 108h incubation to characterize the instant response to methanol induction after the yeast cells are accustomed to methanol media, hence indicating the overall induction activity of the construct. The yeast cells were collected, rinsed and stored at 4˚C overnight to allow GFP to fully degrade. The strains were then incubated in higher-concentration 50mL YNM media (1.34% yeat nitrogenous base with 0.75% methanol, 50µg/mL histidine and 40µg/mL biotin) for 12 hours and sampled every 2 hours. The starting concentration was 3 OD600.
  • Three parallels were performed for each strain.
  • We used a Biotek Synergy 2 plate reader to measure the GFP mean fluorescence intensities and the OD600 absorbance of our samples.
  • Methanol concentration measurements were performed with a Shenzhen Sieman M100 Biosensors Analyzer.
Figure 1. pAOX1-GFP cell concentration curve during the 108h incubation period
Figure 2. pAOX1-GFP measured unit cell GFP production curve during the 108h incubation period
Figure 3. pAOX1-GFP aggregate unit cell GFP production curve during the 108h incubation period
Figure 4. pAOX1-GFP total GFP production curve during the 108h incubation period
Figure 5. pAOX1-GFP total methanol consumption during the 108h incubation period
Figure 6. pAOX1-GFP total GFP production per gram methanol during the 108h incubation period
Figure 6. pAOX1-GFP measured unit cell GFP production curve during the short-term methanol induction period


Data

  • OD600 is used as an indicator of yeast concentration in the experiment.
  • Measured unit cell GFP production is the ratio of the GFP mean fluorescence intensities to the 0D600 absorbance measured by the plate reader. It shall serve as an indicator of the expression level of GFP at the sampled time point.
  • Aggregate unit cell GFP production is the calculated total unit cell GFP fluorescence intensity. It accounts for the GFP that has degraded over the incubation period to more accurately reflect the aggregate production rate.
  • Total GFP production is the product of the yeast concentration and the aggregate unit cell GFP. It reflects the total GFP production of the reaction system of the strain.
  • Total GFP production per gram methanol is the ratio of the total GFP production to the total methanol consumption. It reflects the overall conversion rate of methanol to the product.


  • For teams wishing to compare their data to ours, we've provided our data along with our plate reader calibration data in our wiki. Feel free to give it a check!

Reference

Wang, X., Wang, Q., Wang, J., Zhou, M., Shi, L., Zhou, X., … Shen, W. (2016). Mit1 Transcription Factor Mediates Methanol Signaling and Regulates the Alcohol Oxidase 1 ( AOX1 ) Promoter in Pichia pastoris. Journal of Biological Chemistry, 291(12), 6245–6261. https://doi.org/10.1074/jbc.m115.692053


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]