Difference between revisions of "Part:BBa K3021002"
Line 3: Line 3:
 
<partinfo>BBa_K3021002 short</partinfo>
 
<partinfo>BBa_K3021002 short</partinfo>
  
−
This is a new part designed to allow Laccase secretion from our engineered E.coli strain through embedded the new secretion peptide, NSP4.  
+
This is a new composite part designed to allow Laccase secretion from our engineered E.coli strain through embedded the new secretion peptide, novel signal peptide 4 (NSP4). Laccase is an important enzyme, which would degrade different chemicals. The Laccase sequence in this part is based on the laccase cDNA sequence from Trametes versicolor in iGEM part k863030. Secretion of heterologous proteins into Escherichia coli cell culture medium offers significant advantages for downstream processing over production. NSP4 is utilizing part of the Sec-dependent (Sec) secretion pathway, the general secretion E. coli route. In these, we have further optimized the Laccase and NSP4 sequence.  
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
−
Usage and Biology
+
Usage and Biology>
 +
 
  
−
The original sequence from the paper is ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG with the Protein sequence is The n-region: MKKI(the positive net charge in the n-region: +2) The h-region: TAAAGLLLLA  The c-region: AQPAMA; We have codon optimized this sequence.
 
  
 
<!-- -->
 
<!-- -->

Revision as of 00:16, 15 October 2019


NSP4-Laccase-HisTag

This is a new composite part designed to allow Laccase secretion from our engineered E.coli strain through embedded the new secretion peptide, novel signal peptide 4 (NSP4). Laccase is an important enzyme, which would degrade different chemicals. The Laccase sequence in this part is based on the laccase cDNA sequence from Trametes versicolor in iGEM part k863030. Secretion of heterologous proteins into Escherichia coli cell culture medium offers significant advantages for downstream processing over production. NSP4 is utilizing part of the Sec-dependent (Sec) secretion pathway, the general secretion E. coli route. In these, we have further optimized the Laccase and NSP4 sequence.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    INCOMPATIBLE WITH RFC[12]
    Illegal NheI site found at 92
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 930
    Illegal BglII site found at 1362
    Illegal BamHI site found at 1739
    Illegal XhoI site found at 962
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 145
    Illegal NgoMIV site found at 1601
    Illegal AgeI site found at 329
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 884
    Illegal SapI.rc site found at 394