Difference between revisions of "Part:BBa K3021002"
| Line 6: | Line 6: | ||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
| − | + | Usage and Biology | |
| − | + | ||
The original sequence from the paper is ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG with the Protein sequence is The n-region: MKKI(the positive net charge in the n-region: +2) The h-region: TAAAGLLLLA The c-region: AQPAMA; We have codon optimized this sequence. | The original sequence from the paper is ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG with the Protein sequence is The n-region: MKKI(the positive net charge in the n-region: +2) The h-region: TAAAGLLLLA The c-region: AQPAMA; We have codon optimized this sequence. | ||
Revision as of 00:06, 15 October 2019
NSP4-Laccase-HisTag
This is a new part designed to allow Laccase secretion from our engineered E.coli strain through embedded the new secretion peptide, NSP4.
Sequence and Features
Assembly Compatibility:
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 92
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 930
Illegal BglII site found at 1362
Illegal BamHI site found at 1739
Illegal XhoI site found at 962 - 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 145
Illegal NgoMIV site found at 1601
Illegal AgeI site found at 329 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 884
Illegal SapI.rc site found at 394