Difference between revisions of "Part:BBa K2842680"

Revision as of 02:26, 18 October 2018

Intein Monomer 1: RFP reporter flanked with orthogonal inteins

This gene encodes a novel split-intein flanked reporter device which enables the use of intein splicing for any protein of interest through SapI digestion. Intein Monomer 1 was created to work in conjunction with its complimentary composite part Intein Monomer 2 to construct a intein polymerisation system.

Usage and Biology

Protein Polymerisation by Split Inteins

Discovered in the late 1980s, inteins are naturally occurring protein segments attached to specific host proteins of unicellular organisms (Protein Engineering Handbook, 2009). Inteins contain both an N- and C-terminal domain, which can be split to allow either half to be bound to unique external proteins. Matching split inteins self-excise from their attached host protein in a trans-splicing reaction (depicted in Figure X), which allows for the ligation of the external proteins through a peptide bond.

Figure 1: Protein trans-splicing

Inteins ligate their flanking sequences with a native peptide bond. These sequences can be either their native exteins or unrelated peptides or proteins. (Thiel et al., Angewandte Communications, 2014)

Intein Monomer 1 utilises a Npu-C and an AceL-TerL-N, which are complementary to the flanked inteins on Intein Monomer 2. The Npu-C split intein is the C-terminal domain fragment from a Nostoc punctiforme (Npu) dnaE gene. It possesses more than 98% trans-splicing efficiency, which is greater splicing activity than other species’ DnaE inteins (Iwai et al., 2006). On the other hand, the AceL-TerL-N, derived from phage genes discovered in antarctic permanently stratified saline lakes, is the smallest N-terminal split intein as it is composed of only 25 amino acids (Thiel et al., 2014).

Reporter Protein

Intein Monomer 1 encodes the reporter protein, red fluorescent protein (RFP). RFPs derive from various coral species, and are utilised to emit orange and fluorescence under UV-light (Miyawaki et al., 2013). In particular, Intein Monomer 1 uses a highly engineered mutant RFP isolated from Discosoma striata (coral).

Related Entries in the Registry

The 2018 UCL team utilised the previously existing T7 promoter (BBa_J64997), Strep-tag (BBa_K823038), and terminator (BBa_B1006) within the Intein Monomer 1 design. This part works together with Intein Monomer 2 (BBa_K2842690), which was submitted by the 2018 UCL iGEM team.

New Part Status

Other than these specified registered basic parts, the rest of our Intein Monomer 1 construct is made up of newly submitted basic parts by the 2018 UCL iGEM team, therefore potentially making Intein Monomer 1 a novel biobrick. Intein Monomer 1 is also the only Biobrick registered with a AceL-TerL-C intein.

Usage

Polymerisation

Purified Intein Monomer 1 can react with Purified Intein Monomer 2 to form long polymers because of the orthogonal inteins that are complementary to each other. This polymerisation reaction occurs optimally at the combined reaction temperatures of both split intein species, which are 8°C for AceL-TerL intein and 37°C for Npu intein (Thiel et al., 2014) (Iwai et al., 2006).

Functionalisation

Functional proteins can be Gibson Assembled into Intein Monomer 1. SapI restriction enzymes are used to remove the mRFP1, which creates GGC and GAG overhangs compatible with our Gibson overhangs 5’[GGCGTTGTTTCGCATAACTGTTATAAT]3’ and 5’[TGGAGCCACCCGCAGTTCGAAAAA]3’.

Primer Design

Forward Primer 5’[GCTTCTACAAACGCGGCTTCTT]3’
Reverse Primer 5’[ACGACGCCGgtTACTACATTGA]3’

These are the primers the 2018 UCL team used to PCR amplify and sequence the overall Intein Monomer 1 construct.

Forward Primer 5’[AACGGGTTCATCGCTAGTAATTGTTATAAT]3’
Reverse Primer 5’[AGTGGATCATGGAGCCACCCG]3’

These are the primers the 2018 UCL team used to PCR amplify BBa_K2842681, as well as during colony PCR analysis of any inserted protein of interest.

Figure 2: BsaI digestions

(1) BsaI digested Intein Passenger BBa_K2842669
(2) BsaI digested RFP inteins BBa_K2842680
(3) BsaI digested GFP inteins BBa_K2842690
*edited to show relevant bands

Experimental Approach

DNA Analysis

To confirm the part sequence size, the 2018 UCL team ran BsaI digested samples to cut out Intein Monomer 1 out of the pSB1C3 backbone. This band is shown in Figure 2.1 at around 1200 bp.

Protein Analysis

The 2018 UCL team purified Intein Monomer 1 using a Strep-tag column. We then ran our sample on a SDS page gel against a PageRuler Plus marker, as shown in Figure 3.

Figure 3: SDS Page gel

(1) Purified BBa_K2842680 grown in LB media
(2) Purified BBa_K2842680 grown in TB media
*edited to show relevant bands

Fluorescence Analysis

The 2018 UCL team transformed Intein Monomer 1 into One Shot™ BL21 Star™ (DE3) Chemically Competent E. coli. The cells were cultured in 50mL LB growth medium at 25°C, 30°C and 37°C degrees, until OD600 reached 0.6 when 400μM IPTG was added to induce expression of mRFP1 from the T7 promoter. Fluorescence was then measured after 17 hours of induction using the BMG FLUOstar Omega plate reader. Results are shown in Table 1.

Large Scale Protein Production

To scale-up production of Intein Monomer 1, the 2018 UCL team grew up cultures in 500mL shake flasks and analysed the growth at two temperatures, 25°C and 37°C. The scale-up workflow is documented in Table 2, and the results are depicted in Figures 4 and 5.

Figure 4

Figure 5

Sequence and Features

Functional Parameters

References

1. Protein Engineering Handbook. Chapter 10: Intein in protein engineering. Gillies AR and Wood DW. 2009 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim. Edited by Lutz S and Bornscheuer UT. Pages 271-294.
2. Thiel IV, Volkmann G, Pietrokovski S and Mootz HD. (2014) An atypical naturally split intein engineered for highly efficient protein labeling. Angewandte Communications, Int. Ed., 53: 1306-1310.
3. Iwai H, Zuger S, Jin J and Tam PH. (2006) Highly efficient protein trans-splicing by a naturally split DnaE intein from Nostoc punctiforme. FEBS Letters, 580: 1853-1858.
4. Miyawaki A, Shcherbakiva DM and Verkhusha VV. (2013) Red fluorescent proteins: chromophore formation and cellular applications. Curr Opin Struct Biol, 22: 679-688.