Difference between revisions of "Part:BBa K2748002"

Revision as of 19:14, 17 October 2018

tet-ON promoter

Biology and Usage

Tet-ON promoter is the promoter sequence in the Tet-inducible transcription system (tet-ON system).

Tet-ON system (Gossen et al., 1995) is a inducible transcription system widely used in mammalian cells. The tet-ON system utilizes the sequence-specific DNA binding property of tet repressor protein (tetR) from Escherichia coli in the presence of tet or dox, and consists of two parts: The Tet-inducible CMV promoter (tet-ON promoter) and reverse tetracycline-controlled transactivator (rtTA). The tet-ON promoter consists of tandem tetracycline-responsive elements (TRE) followed by a minimal CMV promoter. The rtTA protein comprises of reverse-tetR (rtetR, mutant of tetR) and activation domains from herpes simplex virus VP16. When tet or dox is added, the rtTA binds to TRE, and VP16 domain will recruit factors of RNA polymerase II to initiate transcription. In the absence of tet or dox, the rtTA detaches from tetON promoter, and thus no transcription.

Design Considerations

The nucleotide sequence was obtained from our host lab. Biobrick prefix and suffix was added by PCR using the following primers,

tetON-prefix: 5’ cggaattcgcggccgcttctagagtttggactaggatcctttaccactc 3’

tetON-suffix: 5’ AActgcagcggccgctactagtaagctctgcttatataggcctcc 3’

and ligated onto the pSB1C3 plasmid backbone obtained from digestion of pSB1C3-lacI-RFP(Part:BBa_J04450). The sequence was comfirmed by Sanger sequencing by IGE Biotechnology LTD using VF2 as the forward primer.

Note that this promoter has basal leaky transcription

Also note that this promoter needs to be used in stable cell lines expressing rtTA or in cells co-transfected with expression vector for rtTA.

Results

For more details, please check out our [http://2018.igem.org/Team:SYSU-CHINA#/Demonstrate result page]!

In iGEM 2018, SYSU-CHINA attempted to develop a reversible safe switch for CAR T therapy based on the tet-inducible CMV promoter and U24 protein of Human Herpesvirus 6. Since it is the major part of our project, we conducted extensive research on U24 and obtained valuable results..

In order to determine the optimal concentration of dox for induction, equal amount of HEK293T cells were seeded in 6-well plates and transfected with ptetON-GFP-T2A-U24. Different concentration of dox was added to each well immediately after transfection. For comparison, pEF1a-GFP-T2A-U24 was used as a positive control. 3 fluorescence images of each well were captured and analyzed with ImageJ for fluorescence intensity 24h after introduction of dox. And equal amount of cells were harvested for western blots analysis.

In the absence of Dox, the transient transfected cells exhibited low level of fluorescence, the fluorescence intensity increased as the concentration increase and reached a plateau. In agreement with the fluorescence data, the result from western blot analysis also indicated a rapid increase on expression level at low level of dox and soon reached a plateau after the concentration exceeded 100ng/ml. Thus we reasoned that 100ng/ml is the lowest concentration needed for optimal induction. However, the basal expression level was high, since only 3-fold increase at optimal condition compared to no induction.

Figure 2: Fluorescence and western blot analysis of U24 expression under different concentration of doxycycline

In order to determine the expression time course after adding dox, equal amount of HEK293T cells were seeded in a 6-well plate and transfected with ptetON-GFP-T2A-U24. Dox was added at the same time in all wells and equal number of cells in each well were harvested at the indicated time for western blot analysis. The result was analyzed with ImageJ and the amount of protein of interest was normalized using β-actin as internal controls.

We observed an increase of HA-tagged protein level over the time of 24h and reached a plateau at around 6h, confirming a relatively fast response. However, the fold change was small that a less than 2-fold change was observed, indicating insufficient induction. Due to the time limits, we were unable to conduct additional experiments and more repeats are needed to further validate the results.

Figure 3: Time course of U24 expression

References

Gossen, M., Freundlieb, S., Bender, G., Muller, G., Hillen, W., and Bujard, H. (1995). Transcriptional activation by tetracyclines in mammalian cells. Science 268, 1766-1769.

Sequence and Features