Difference between revisions of "Part:BBa K2515002"
Line 11: | Line 11: | ||
'''iGEM18_Bulgaria:''' | '''iGEM18_Bulgaria:''' | ||
− | We improved the gRNA expression vector pSB1C3-gRNA - part BBa_K2515002 from the Registry. It was originally designed by the iGEM Bulgaria 2017 team for easy cloning and expression of gRNAs in E. coli. Nevertheless, it is a high copy number vector with no easy option for a plasmid curing. To overcome these limitations, we PCR amplified the pSC101-based thermosensitive origin of replication from the pE-FLP vector (Plasmid #45978). Next, we developed an aqua cloning-based approach to substitute the original pSB1C3 origin with this new part. The resulting vector was low copy number (that is sufficient for gRNA expression due to the high efficiencies of the CRISPR/Cas9 systems) and can be eliminated by cultivation at 42oC. | + | We improved the gRNA expression vector pSB1C3-gRNA - part <partinfo>BBa_K2515002</partinfo> from the Registry. It was originally designed by the iGEM Bulgaria 2017 team for easy cloning and expression of gRNAs in E. coli. Nevertheless, it is a high copy number vector with no easy option for a plasmid curing. To overcome these limitations, we PCR amplified the pSC101-based thermosensitive origin of replication from the pE-FLP vector (Plasmid #45978). Next, we developed an aqua cloning-based approach to substitute the original pSB1C3 origin with this new part. The resulting vector was low copy number (that is sufficient for gRNA expression due to the high efficiencies of the CRISPR/Cas9 systems) and can be eliminated by cultivation at 42oC. |
Revision as of 18:51, 17 October 2018
gRNA expression vector for use with Cas9 or dCas9
This is the pSB1C3-gRNA vector designed and used by Team Bulgaria 2017. Our gRNA cloning cassette consist of four functional regions. First comes the constitutive promoter J23119 with defined transcription start. It is fused to the second base pairing region which itself is surrounded by two unique Eco31I sites. Next comes a gRNA scaffold region followed by a S. pyogenes terminator.
For more details and protocols - see Design page.
For a functional test of cloned gRNAs - see Experience page.
iGEM18_Bulgaria:
We improved the gRNA expression vector pSB1C3-gRNA - part BBa_K2515002 from the Registry. It was originally designed by the iGEM Bulgaria 2017 team for easy cloning and expression of gRNAs in E. coli. Nevertheless, it is a high copy number vector with no easy option for a plasmid curing. To overcome these limitations, we PCR amplified the pSC101-based thermosensitive origin of replication from the pE-FLP vector (Plasmid #45978). Next, we developed an aqua cloning-based approach to substitute the original pSB1C3 origin with this new part. The resulting vector was low copy number (that is sufficient for gRNA expression due to the high efficiencies of the CRISPR/Cas9 systems) and can be eliminated by cultivation at 42oC.
NB! The generated vector is a low copy number plasmid, thus, one needs to use reduced antibiotic concentrations and the colony growth requires more time. In addition, the pSC101 ori contains a SpeI restriction site and, therefore, is not BioBrick RCF10-compatible! If you need to use it – adopt the aqua cloning procedure from the part’s page in the Registry.
We submitted a new part BBa_K2847002 – it contains the thermosensitive replication origin and can be used as a template in PCR amplification reactions
Protocol for Aqua cloning based origin replacement:
Primer pair for pSC101* thermosensitive origin amplification
Primer_F: CAGGTTTGTGCCAATACCAG
Primer_R CAGCGATTTGCCCGATTGC
You can use either part BBa_K2847002 or pE-FLP (Addgene Plasmid #45978) as a matrix.
24-bp overhangs for the BioBrick vector backbone amplification
cggccgcaatcgggcaaatcgctg
tctactggtattggcacaaacctg
Next all you have to do is to perform a standard Aqua cloning procedure - for more details you can see doi.org/10.1371/journal.pone.0137652
Have in mind that the new origin will transform your vector in a low copy number one so in many cases you have to reduce the antibiotic concentrations to obtain colonies. Also the colonies growth can take a bit longer since they have to be cultivated at 30oC.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 8
Illegal NheI site found at 31 - 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 64
Illegal BsaI.rc site found at 38