Difference between revisions of "Part:BBa K2834003"

Revision as of 18:25, 17 October 2018

Expressible apidaecin antimicrobial peptide from Apis mellifera

This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, apidaecin, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of apidaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.

As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 2 and the His-tag. The exact synthesized sequence is:
CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTC

Usage and Biology

In the last few years, a lot of effort has been concentrated in the search of new alternative treatments against infections. Apidaecins are antimicrobial peptides isolated from lymph fluid of the adult honeybee that have come to address this necessity². Structurally, these peptides are composed of 18 residues, containing 6 prolines (33%). This composition provides Apidaecin with a helical structure, antibacterial capacity, and high stability at acidic conditions. These properties have made Apidaecin a potential novel antibiotic drug¹.

The mechanism of action of Apidaecin starts with the binding of the peptides to the outer membrane of bacteria. This binding is followed by the invasion of the periplasmic space, and by an irreversible combination with a receptor/docking molecule, component of a permease-type transporter system on inner membrane drug³. In our project, this mechanism of action suggested the use of Apidaecin as an alternative treatment against two diseases that affect Honeybee larvae, the American and European foulbrood.

Characterization of apidaecin atimicrobial peptide

This composite will be characterized with the intention of expressing abaecin in E. coli BL21 (DE3) by IPTG induction. Subsequently, its antimicrobial activity will be evaluated against Gram-positive bacteria with antibiotimicrobial susceptibility testing by measuring OD₆₀₀ in broth.

BioBrick™ assembly

To achieve this goal, firstly, the composite was synthesized by IDT® with the prefix and suffix flanking the region of interest. The final part resulted in a sequence of 310 base pairs. Once the synthesis arrived, double digestion with EcoRI-HF and PstI restriction enzymes was made to the composite, and the chloramphenicol linearized plasmid backbone (pSB1C3) for following ligation of both fragments. This resulted in a complete expression plasmid of 2337 base pairs. Afterward, Escherichia coli BL21(DE3) was transformed by heat shock for following the antibiotic selection of clones. Next step consisted of plasmid extraction and electrophoresis gel of the uncut plasmid, linearized plasmid with one enzyme, and linearized plasmid with two enzymes. This agarose gel allowed the confirmation of the correct plasmid construction.