Difference between revisions of "Part:BBa K2834006"
Danielaolono (Talk | contribs) |
Danielaolono (Talk | contribs) |
||
| Line 55: | Line 55: | ||
S. pyogenes (figure 2b) was treated with the same concentrations as B. subtilis. At 21 h, both concentrations of abaecin produced a decrease in OD600 compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with abaecin OD600 decreases in 3.77% and with the highest one it decreases in 14.39%. | S. pyogenes (figure 2b) was treated with the same concentrations as B. subtilis. At 21 h, both concentrations of abaecin produced a decrease in OD600 compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with abaecin OD600 decreases in 3.77% and with the highest one it decreases in 14.39%. | ||
| − | <center>[[File:bacteria vs abaecin.png|650px]] | + | <center>[[File:bacteria vs abaecin.png|650px]] |
<center><div class="row"> | <center><div class="row"> | ||
<div class="col-md-12"> | <div class="col-md-12"> | ||
| − | <sub><b>Figure 1. </b>(On the left) SnapGene® map of BBa__K2834006. (On the right) Agarose gel electrophoresis of BBa__K2834006 compared with NEB Quick-Load® Purple 1Kb Plus DNA Ladder, where the highlighted band corresponds to approximately 2388 bp.</sub> | + | <sub><b>Figure 1. </b>(On the left) SnapGene® map of BBa__K2834006. (On the right) Agarose gel electrophoresis of BBa__K2834006 compared with NEB Quick-Load® Purple 1Kb Plus DNA Ladder, where the highlighted band corresponds to approximately 2388 bp.</sub></center> |
</div><br> | </div><br> | ||
Revision as of 17:40, 17 October 2018
Expressible abaecin antimicrobial peptide from Apis mellifera
This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, abaecin, a 6x His-Tag and a T1 terminator from E. coli. This composite enables the expression of abaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, abaecin and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTCCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAA AGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC
Usage and Biology
Antimicrobial peptides (AMPs) are oligopeptides with a varying number (from five to over a hundred) of amino acids that have a broad spectrum of targeted organisms ranging from viruses to parasites1. AMPs are molecules present in the immune system of multinuclear organisms, acting in the defense against invaders such as gram-positive, gram-negative bacteria and fungi3.
The antimicrobial effect of peptides, and their production, has been studied in the immunological system of animals, such as bees. These peptides were directly extracted from the animal’s hemolymph, which were purified and tested in bacterial culture, presenting antimicrobial activity3.
Recently, four families of AMPs (i.e., apidaecins, abaecin, hymenoptaecin and defensins) have been described in the honey bee2. The abaecin peptide, found in Apis mellifera, is one of the largest proline-rich antimicrobial peptide, with 34 amino acids containing 10 prolines (29%) and no cysteine residues. Prolines are uniformly distributed through the peptide length, preventing the α-helical conformation3. Abaecin inhibits growth of G+ bacteria. The abaecin precursor was found both in adult bees and in bee brood hemolymph. Expression and abundance of abaecin is rapidly up-regulated in response to bacterial infection, there is a time-dependent increase in expression of this peptide in first-instar larvae after P. larvae spores exposure2. In our project, abaecin is expressed in E. coli BL21 (DE3) to be used against the bacteria that cause American and European Foulbrood.
Characterization of abaecin atimicrobial peptide
This composite will be characterized with the intention of expressing abaecin in E. coli BL21 (DE3) by IPTG induction. Subsequently, its antimicrobial activity will be evaluated against Gram-positive bacteria with antibiotic susceptibility testing by measuring OD600 in broth.
BioBrick™ assembly
To achieve this goal, firstly, the composite was synthesized by IDT® with the prefix and suffix flanking the region of interest. The final part resulted in a sequence of 361 base pairs. Once the synthesis arrived, double digestion with EcoRI-HF and PstI restriction enzymes was made to the composite, and the chloramphenicol linearized plasmid backbone (pSB1C3) for following ligation of both fragments. This resulted in a complete expression plasmid of 2388 base pairs. Afterward, Escherichia coli BL21(DE3) was transformed by heat shock for following antibiotic selection of clones. Next step consisted of plasmid extraction and electrophoresis gel of the uncut plasmid, linearized plasmid with one enzyme, and linearized plasmid with two enzymes. This agarose gel allowed the confirmation of the correct plasmid construction.
Figure 1. (On the left) SnapGene® map of BBa__K2834006. (On the right) Agarose gel electrophoresis of BBa__K2834006 compared with NEB Quick-Load® Purple 1Kb Plus DNA Ladder, where the highlighted band corresponds to approximately 2388 bp.
IPTG protein induction and extraction
Following the construction of the BioBrick, it was necessary to induce protein production. Since the T7 promoter regulates transcription of the construct, isopropyl β-D-1 thiogalactopyranoside (IPTG) is used as an inducer for T7 RNA polymerase production. The concentration of IPTG used was 0.5 mM. After induction, the cultures were incubated for six hours at 37 °C and 225 rpm. After that, protein extraction by lysis solution was made in order to obtain the soluble peptides. For insoluble peptides, the sample was treated with lysis solution+6M urea.
SDS-PAGE
After protein extraction, electrophoresis in a polyacrylamide gel (12%) was performed to corroborate the peptide of interest was indeed expressed. To calculate the molecular weight of the peptide, the Promega Biomath Calculator was used. The DNA length (bp) of the peptide was introduced, and Promega’s tool calculated the molecular weight in kDa. For abaecin, a band at 5.94 kDa was expected.
Antibiotic susceptibility testing
In order to prove the antimicrobial activity of abaecin, antimicrobial susceptibility tests were performed for two different bacteria: Bacillus subtilis and Streptococcus pyogenes. B. subtilis was chosen because it is one of the best known Gram-positive microorganisms and S. pyogenes was chosen because it is one of the most important bacterial pathogens to humans. They both are widely known, commonly used, and thus allowed to better analyze the activity that the peptide has.
Being unable to isolate our peptides by affinity tag purification due to lack of equipment, crude protein extract was used in the experiment. In order to validate the experiment, different concentrations of the peptide and several controls were used; 15 ml of LB broth, with a bactericide agent or a control, were inoculated with 100μl of the overnight culture of each bacteria. Afterward, OD600 was measured at 3, 6, 9, and 21 hours after inoculation.
Antibiotic susceptibility test results
B. subtilis (figure 2a) was treated with 29.74 μg/mL (LC) and 148.7 μg/mL (HC) of total proteins of transformed E. coli BL21 (DE3) with abaecin. Also, it was treated with 29.565 μg/mL (LC) and 147.825 μg/mL (HC) of untransformed E. coli BL21 (DE3) for negative control. A culture of B. subtilis was used as a negative control as well. At 21 h, both concentrations of abaecin produced a decrease in OD600 compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with abaecin OD600 decreases in 16.08% and with the highest one it decreases in 17.16%.
S. pyogenes (figure 2b) was treated with the same concentrations as B. subtilis. At 21 h, both concentrations of abaecin produced a decrease in OD600 compared to the untransformed E. coli BL21 (DE3) control. With the lowest concentration of total proteins with abaecin OD600 decreases in 3.77% and with the highest one it decreases in 14.39%.
<center>
<center>
Figure 1. (On the left) SnapGene® map of BBa__K2834006. (On the right) Agarose gel electrophoresis of BBa__K2834006 compared with NEB Quick-Load® Purple 1Kb Plus DNA Ladder, where the highlighted band corresponds to approximately 2388 bp.</center>
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 86
- 1000COMPATIBLE WITH RFC[1000]
References
<p align="justify">
1. Bahar, A., & Ren, D. (2013). Antimicrobial Peptides. Pharmaceuticals, 6(12), 1543–1575. doi.org/10.3390/ph6121543
2. Danihlík, J., Aronstein, K., & Petřivalský, M. (2015). Antimicrobial peptides: a key component of honey bee innate immunity. Journal of Apicultural Research, 54(2), 123–136. doi:10.1080/00218839.2015.1109919
3.Prudencio, D., Franco, J., Goulart, L., Nicolau, N. & Ueira, C. (2017). Heterologous expression of abaecin peptide from Apis mellifera in Pichia pastoris. Microbial Cell Factories. doi.org/10.1186/s12934-017-0689-6
</p>