Difference between revisions of "Part:BBa K2834006"

Revision as of 16:22, 17 October 2018

Expressible abaecin antimicrobial peptide from Apis mellifera

This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, abaecin, a 6x His-Tag and a T1 terminator from E. coli. This composite enables the expression of abaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.

As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, abaecin and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTCCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAA AGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC

Usage and Biology

Antimicrobial peptides (AMPs) are oligopeptides with a varying number (from five to over a hundred) of amino acids that have a broad spectrum of targeted organisms ranging from viruses to parasites¹. AMPs are molecules present in the immune system of multinuclear organisms, acting in the defense against invaders such as gram-positive, gram-negative bacteria and fungi³.

The antimicrobial effect of peptides, and their production, has been studied in the immunological system of animals, such as bees. These peptides were directly extracted from the animal’s hemolymph, which were purified and tested in bacterial culture, presenting antimicrobial activity³.

Recently, four families of AMPs (i.e., apidaecins, abaecin, hymenoptaecin and defensins) have been described in the honey bee². The abaecin peptide, found in Apis mellifera, is one of the largest proline-rich antimicrobial peptide, with 34 amino acids containing 10 prolines (29%) and no cysteine residues. Prolines are uniformly distributed through the peptide length, preventing the α-helical conformation³. Abaecin inhibits growth of G+ bacteria. The abaecin precursor was found both in adult bees and in bee brood hemolymph. Expression and abundance of abaecin is rapidly up-regulated in response to bacterial infection, there is a time-dependent increase in expression of this peptide in first-instar larvae after P. larvae spores exposure². In our project, abaecin is expressed in E. coli BL21 (DE3) to be used against the bacteria that cause American and European Foulbrood.

Characterization of abaecin atimicrobial peptide

This composite will be characterized with the intention of expressing abaein in E. coli BL21 (DE3) by IPTG induction. Subsequently, its antimicrobial activity will be evaluated against Gram-positive bacteria with antibiotic susceptibility testing by measuring OD₆₀₀ in broth.

BioBrick™ assembly

BBa_K283406 BioBrick composite is intended to be expressed in Escherichia coli BL21. To achieve this goal, firstly, the composite was synthesized by IDT® with the prefix and suffix flanking the region of interest. The final part resulted in a sequence of 415 base pairs. Once the synthesis arrived, double digestion with EcoRI-HF and PstI restriction enzymes was made to the composite, and the chloramphenicol linearized plasmid backbone (pSB1C3) for following ligation of both fragments. This resulted in a complete expression plasmid of 2442 base pairs. Afterward, Escherichia coli BL21(DE3) was transformed by heat shock for following antibiotic selection of clones. Next step consisted of plasmid extraction and electrophoresis gel of the uncut plasmid, linearized plasmid with one enzyme, and linearized plasmid with two enzymes. This agarose gel allowed the confirmation of the correct plasmid construction.