Difference between revisions of "Part:BBa K2789027"

Latest revision as of 14:37, 17 October 2018

Plac+RBS+lectin-FimH+terminator

This part is the standard expression pathway of K2789026： lectin-FimH， this part can also display the lectin to the surface of the bacteria. Lectin is a protein that originally from Green algae. It has positive charge thus can bind with EPS(exopolysubstance),which is secreted by algae. In our project, we wanted our bacteria to connect with the algae to strengthen the symbiotic biofilm. Thus we wanted to make it expressed on the surface of bacteria. Fusing lectin with FimH is another way to display it on bacteria surface. FimH is a part of pili，some teams had identified that make fused protein with this protein can make the target protein expressed on the surface.

Description

We added lacl promoter and standard RBS and double terminator to make the BBa_K2789026 a complete pathway to be expressed. The instability of biofilm is a big problem in this field currently. This part can improve the stability of symbiotic biofilm of algae and bacteria, The basic part BBa_K2789026 can be divided into two parts——“FimH” which is a component of flagella. Team Exeter-2016 fused metal binding protein with this FimH and successfully make it on the surface of the bacteria. This process is similar to ”surface display” . We took their idea and their experience in this part. Another part of this basic part is lectin, which can bind polysaccharide due to its plenty of positive charges. EPS(exopolysaccharide) is excreted by algae and exists in its surroundings.

We expressed it with OmpA so lectin can be expressed on the surface of the bacteria, and algae usually has a large quantity of polysaccharide in its surroundings, which is called “EPS”, (exopolysaccharide). This coding sequence can make our bacteria “stick” to the algae in this way.

Measurement

To measure how much it can improve the connection between algae and bacteria, we did a series of experiments. Firstly we found the condition of co-culture of bacteria and algae, excluding optimal ratio and culture condition. Then we make it a biofilm by suction filtration method.

In order to test the stability quantitively, we chose shear force as interference after some failed attempts, the shear force has physical Meaning because it plays that interference also in micro-scale directly to the connection between bacteria and algae, compared with that, shaking or pump don’t. Also, the effect of shear force is uniform to biofilm.

We use this device to create proper shear force by adjusting rotating time and speed.

We used shedding rate to determine the stability of biofilm and connection strength between two organisms. We put the biofilm onto the inner wall of the cylinder and start stirring the stirrer. After stirring, Collect algae A that remain on the biofilm and exfoliated algae B. Then count A and B separately. shedding rate “B/(A+B)×100% “can be calculated. The number of each organism was counted by very precise methods——chlorophyll method and hemocytometer Counting method. After a series of standard-establishment experiments, we use 250r/s, 3min as a standard because It can better distinguish the level of biofilm bonding strength.

Result

Then we transformed our pathway into bacteria(We actually assembled the pathway into PsB1C3 and PeT28a separately, since the unit is pathway, there should be no dramatic difference between two experimental results) and made it a biofilm with algae. The stability that it improved can be seen by the figure.

We use LB and WT bacteria as control. You can see that this part in both two plasmids have a similar results and a decline of shedding rate in 250r.3min condition. Due to the time limit, we didn’t explore the best condition for the expression and adjust the biofilm formation steps to make it work better. However, although we didn’t do this adjustment, it still worked as expect and did improve the stability of biofilm. A further experiment will be done according to this and we believe it can greatly improve the effect!

Design: We synthesized it in PeT28a and then we used PCR to add a prefix and suffix and then used restriction enzyme+ligase to transfer the pathway into the PsB1C3 backbone.

Primer:
5‘-CGGAATTCGCGGCCGCTTCTAGAG AATTGTGAGCGGATAACAATTGAC-3’
FimH Reverse:
5’- GGTACTAGTAGCGGCCGCTGCAG CTCTAGTATATAAACGCAGAAAGGC-3’

Sequence and Features