Difference between revisions of "Part:BBa K2794003"
Line 25: | Line 25: | ||
WW domain is a 40 amino acid length domain that can primarily bind to PPxY motif. It was first discovered on NEDD4 protein, enabling NEDD4 to bind with Ndfip, thus initiating ubquitination. Soon the interaction between WW domain and PPxY motif was found in many irrelevant signaling pathway including viral gag proteins, interleukin receptors and several serine/threonine kinases , indicating a universal significance. It’s worth to mention that WW domain on NEDD4 specifically can bind to an in vitro PY motif, which permits a more flexible way for experiments. | WW domain is a 40 amino acid length domain that can primarily bind to PPxY motif. It was first discovered on NEDD4 protein, enabling NEDD4 to bind with Ndfip, thus initiating ubquitination. Soon the interaction between WW domain and PPxY motif was found in many irrelevant signaling pathway including viral gag proteins, interleukin receptors and several serine/threonine kinases , indicating a universal significance. It’s worth to mention that WW domain on NEDD4 specifically can bind to an in vitro PY motif, which permits a more flexible way for experiments. | ||
− | [[T--SHSU_China--NEDD4.png|400px|]] | + | [[File:https://static.igem.org/mediawiki/2018/6/64/T--SHSU_China--NEDD4.png|400px|]] |
'''Figure 1: NEDD4''' | '''Figure 1: NEDD4''' | ||
Line 38: | Line 38: | ||
'''WW3-Reverse:'''TGCACTGCAGGCTCTAGACGGAATTTTCAGACGCGGATCTT | '''WW3-Reverse:'''TGCACTGCAGGCTCTAGACGGAATTTTCAGACGCGGATCTT | ||
− | [[T--SHSU_China-- | + | [[File:https://static.igem.org/mediawiki/2018/6/64/T--SHSU_China--NEDD4.png|600px|]] |
'''Figure 2: Plasmids used in the experiments''' | '''Figure 2: Plasmids used in the experiments''' |
Revision as of 14:31, 17 October 2018
WW Domain 3
WW Tag 3 | |
---|---|
Function | Active Cargo Loading for Exosomes |
Use in | Mammalian cells |
RFC standard | RFC 10 compatible |
Backbone | pSB1C3 |
Submitted by | [http://2018.igem.org/Team:SHSU_China SHSU_China] |
Overview
WW domain is a 40 amino acid length domain that can primarily bind to PPxY motif. It was first discovered on NEDD4 protein, enabling NEDD4 to bind with Ndfip, thus initiating ubquitination. Soon the interaction between WW domain and PPxY motif was found in many irrelevant signaling pathway including viral gag proteins, interleukin receptors and several serine/threonine kinases , indicating a universal significance. It’s worth to mention that WW domain on NEDD4 specifically can bind to an in vitro PY motif, which permits a more flexible way for experiments.
File:Https://static.igem.org/mediawiki/2018/6/64/T--SHSU China--NEDD4.png
Figure 1: NEDD4
In experiments, in order to obtain the best binding efficiency with PPxY motif, Team SHSU_China chose the third and fourth from all 4 WW domains on NEDD4 to continue.
Design
Team SHSU_China used sequence of WW domain 3 from Human Nedd4 sequence and added HindIII and XbaI when designing the sequence. The following primers are used to sequence the Tags:
WW Tag-Forward:CCGGAATTCCCCAAGCTTCGTCGTGCCT
WW3-Reverse:TGCACTGCAGGCTCTAGACGGAATTTTCAGACGCGGATCTT
File:Https://static.igem.org/mediawiki/2018/6/64/T--SHSU China--NEDD4.png
Figure 2: Plasmids used in the experiments
Prove of Expression
Team SHSU_China used HEK 293T cells in their exosome experiments. After using sequencing to conform the sequence, 2ug of vector (or 2ug+2ug) is transfected to a 60mm plate using lipofectamine 2000. Exosomes are extracted from the 4ml culture media using total exosome isolation kit (from cell culture media) from Invitrogen. Cells and exosomes are lysed using Ripa.
Cell content western blotting first proved successful translation of PNW3V plasmids inside HEK 293T cells. Exosome content shown pale fusion protein band around 30kda. TEM result of sample shown that the protein doesn’t effect the shape or the concentration of exosomes. COD result compared to normal exosomes shown that the COD value increased but the difference is not as huge as PNCV transfected once.
Figure 3: Results
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]