Difference between revisions of "Part:BBa K2591012"
(→‎Usage and Biology)
 
Line 6: Line 6:
 
Naturally, single guide RNA(sgRNA) is a small RNA which guides CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, <i>Nat. Protoc.</i>, 2013)   
 
Naturally, single guide RNA(sgRNA) is a small RNA which guides CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, <i>Nat. Protoc.</i>, 2013)   
  
−
<div style="zoom:50%">
+
<div style="zoom:25%">
 
<center>
 
<center>
 
https://static.igem.org/mediawiki/2018/f/f6/T--SUSTech_Shenzhen--Silver_part_in_Wiki_page_P1_%EF%BC%86_%E9%93%B6%E7%89%8CBBa_K259101_P1.png
 
https://static.igem.org/mediawiki/2018/f/f6/T--SUSTech_Shenzhen--Silver_part_in_Wiki_page_P1_%EF%BC%86_%E9%93%B6%E7%89%8CBBa_K259101_P1.png

Latest revision as of 10:14, 17 October 2018


gWnt3a-scaffold

Usage and Biology

Naturally, single guide RNA(sgRNA) is a small RNA which guides CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013)

T--SUSTech_Shenzhen--Silver_part_in_Wiki_page_P1_%EF%BC%86_%E9%93%B6%E7%89%8CBBa_K259101_P1.png

Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc,, 2013)

In our project, we design a gRNA for wingless-type MMTV integration site family, member 3A (Wnt3A). Wnt3A protein is a secretion protein function in the development and proliferation of the normal cell, and more importantly, canonical Wnt pathway play a role in the induction of cancer. In our part, we want to explore the upstream of the Wnt pathway, and want to find the gene factors which affect the Wnt pathway by the high-throughput double emulsion system. Thus, we design this gRNA for Wnt protein coding sequence as a positive control. And we have integrated this gRNA together with its scaffold into the backbone pSB1C3 to get a new part.(Fig2)

T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591012_P2.png

Figure2. Diagram of pSB1C3_gRNA_scaffold.

Characterization

target length: 20nt

target sequence: ACCGTCACAACAATGAGGCT

primer for plasmid construction: wnt3a-gRNA1-F 5' -CACCGACCGTCACAACAATGAGGCT-3'

wnt3a-gRNA1-R 5' -AAACAGCCTCATTGTTGTGACGGTC- 3'

Location in gene loci:

T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591012_P3.png

Figure 3. gRNA is designed to a conserved sequence of a exon of the Wnt3A protein coding sequence of mouse (From NCBI)

As mentioned above, knockout of PORCN will impair the Wnt3a secretion activity in the cells. Therefore, we first introduce sgPor into L-Wnt3A-Cas9-mCherry cell line, which continuously expresses Cas9 protein. And then coculture with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence after one day to validate our part. We also observed the validated results using FACS. Validation images are shown in Fig4 and Fig5.

T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591012_P4.png

Figure4. Knockout of WNT show no wnt secretion, fluorescence validation. First row: normal 293R cell line. Second row: 293R cell line cultured with L-cell with WNT knockout. Third row: 293R cell line cultured with L-cell with no target knockout. Column legends indicated the observation field, merged means artificial adding of red and green. We cannot see green fluorescent protein at the green filed(475nm), it means the Wnt3A protein cannot be secreted from the L cell normally, and the gRNA designed for WNT could target specific sequence and did mutate it with Cas9 protein.

T--SUSTech_Shenzhen--%E9%93%B6%E7%89%8CBBa_K2591012_P5.png

Figure5. Knockout of WNT show no wnt secretion, FACS validation. (a) Coculture of L cell-NON-target-KO with 293R-TCF-GFP in 24 hours. (b) Coculture of L cell-NON-target-KO with 293R-TCF-GFP in 0 hours. (c) Coculture of L cell-WNT-KO with 293R-TCF-GFP in 24 hours.

Reference

Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A., & Zhang, F. (2013). Genome engineering using the CRISPR-Cas9 system.  Nature protocols, 8(11), 2281.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]