Difference between revisions of "Part:BBa K2560012:Design"
Line 4: | Line 4: | ||
<partinfo>BBa_K2560012 SequenceAndFeatures</partinfo> | <partinfo>BBa_K2560012 SequenceAndFeatures</partinfo> | ||
− | |||
===Design Notes=== | ===Design Notes=== | ||
− | + | <html> | |
+ | <p align="justify"> | ||
+ | This connectors were designed to enable flexible cloning of LVL 2 plasmids. For more informations feel free to visit our <a href="http://2018.igem.org/Team:Marburg/Design">Design Page</a>. | ||
+ | </html> | ||
+ | ===Source=== | ||
+ | <html> | ||
+ | The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector <a href="https://parts.igem.org/Part:BBa_K2560002">BBa_K2560002</a> using Golden Gate assembly. If you stuggle with <i> de novo </i> synthesis we recomended this | ||
+ | <a href="https://parts.igem.org/Help:Promoters/Construction">site</a>. | ||
+ | </html> | ||
+ | <b> Forward Oligo:</b> | ||
+ | CTCGCGCTTACTAGTAGCGGCCGCTGCAGAGCT | ||
− | + | <b> Reverse Oligo:</b> | |
− | + | CTCAAGCTCTGCAGCGGCCGCTACTAGTAAGCG | |
− | + | ||
− | + | ||
− | + |
Latest revision as of 00:06, 17 October 2018
Phytobrick version of 3'Connector Dummy
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal suffix found in sequence at 1
- 12INCOMPATIBLE WITH RFC[12]Illegal SpeI site found at 2
Illegal PstI site found at 16
Illegal NotI site found at 9 - 21COMPATIBLE WITH RFC[21]
- 23INCOMPATIBLE WITH RFC[23]Illegal suffix found in sequence at 2
- 25INCOMPATIBLE WITH RFC[25]Illegal SpeI site found at 2
Illegal PstI site found at 16 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
This connectors were designed to enable flexible cloning of LVL 2 plasmids. For more informations feel free to visit our Design Page.
Source
The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector BBa_K2560002 using Golden Gate assembly. If you stuggle with de novo synthesis we recomended this site.
Forward Oligo: CTCGCGCTTACTAGTAGCGGCCGCTGCAGAGCT
Reverse Oligo: CTCAAGCTCTGCAGCGGCCGCTACTAGTAAGCG