Difference between revisions of "Part:BBa K2560011:Design"
Line 4: | Line 4: | ||
<partinfo>BBa_K2560011 SequenceAndFeatures</partinfo> | <partinfo>BBa_K2560011 SequenceAndFeatures</partinfo> | ||
− | |||
===Design Notes=== | ===Design Notes=== | ||
− | + | <html> | |
+ | The sequence was synthesized <i> in silico </i> by Daniel Stukenberg and ordered from <a href="https://eu.idtdna.com/pages">Integrated DNA Technologies</a>(IDT). | ||
+ | </html> | ||
+ | ===Source=== | ||
+ | <html> | ||
+ | The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector <a href="https://parts.igem.org/Part:BBa_K2560002">BBa_K2560002</a> using Golden Gate assembly. If you stuggle with <i> de novo </i> synthesis we recomended this | ||
+ | <a href="https://parts.igem.org/Help:Promoters/Construction">site</a>. | ||
+ | </html> | ||
+ | <b> Forward Oligo:</b> | ||
+ | CTCGAACAGAATTCGCGGCCGCTTCTAGAGGGAG | ||
+ | <b> Reverse Oligo:</b> | ||
+ | CTCACTCCCTCTAGAAGCGGCCGCGAATTCTGTT | ||
− | |||
− | |||
− | |||
− | |||
===References=== | ===References=== |
Revision as of 10:57, 16 October 2018
Phytobrick version of 5'Connector Dummy
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal prefix found in sequence at 1
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 1
Illegal NotI site found at 7 - 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 1
- 23INCOMPATIBLE WITH RFC[23]Illegal prefix found in sequence at 1
- 25INCOMPATIBLE WITH RFC[25]Illegal prefix found in sequence at 1
Illegal XbaI site found at 16 - 1000COMPATIBLE WITH RFC[1000]
Design Notes
The sequence was synthesized in silico by Daniel Stukenberg and ordered from Integrated DNA Technologies(IDT).
Source
The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector BBa_K2560002 using Golden Gate assembly. If you stuggle with de novo synthesis we recomended this site.
Forward Oligo: CTCGAACAGAATTCGCGGCCGCTTCTAGAGGGAG Reverse Oligo: CTCACTCCCTCTAGAAGCGGCCGCGAATTCTGTT