Difference between revisions of "Part:BBa K2834003"
Danielaolono (Talk | contribs) |
Danielaolono (Talk | contribs) |
||
| Line 38: | Line 38: | ||
2. Mishra, A., Choi, J., Moon, E., & Baek, K.-H. (2018). Tryptophan-Rich and Proline-Rich Antimicrobial Peptides. Molecules, 23(4), 815. https://doi.org/10.3390/molecules23040815 | 2. Mishra, A., Choi, J., Moon, E., & Baek, K.-H. (2018). Tryptophan-Rich and Proline-Rich Antimicrobial Peptides. Molecules, 23(4), 815. https://doi.org/10.3390/molecules23040815 | ||
<br> | <br> | ||
| − | 3. Wei-Fenm L., Guo-Xia, M., & Xu-Xia, Z. (2006). Apidaecin-type peptides: Biodiversity, structure–function relationships and mode of action. National Institute for Biotechnology Information. 10.1016/j.peptides.2006.03.016 | + | 3. Wei-Fenm L., Guo-Xia, M., & Xu-Xia, Z. (2006). Apidaecin-type peptides: Biodiversity, structure–function relationships and mode of action. National Institute for Biotechnology Information. DOI: 10.1016/j.peptides.2006.03.016 |
<br> | <br> | ||
</p> | </p> | ||
Revision as of 04:59, 15 October 2018
Expressible apidaecin antimicrobial peptide from Apis mellifera
This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, apidaecin, a 6x His-Tag, and a T1 terminator from E. coli. This composite enables the expression of apidaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 2 and the His-tag. The exact synthesized sequence is:
CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTC
Usage and Biology
In the last few years, a lot of effort has been concentrated in the search of new alternative treatments against infections. Apidaecins are antimicrobial peptides isolated from lymph fluid of the adult honeybee that have come to address this necessity2. Structurally, these peptides are composed of 18 residues, containing 6 prolines (33%). This composition provides Apidaecin with a helical structure, antibacterial capacity, and high stability at acidic conditions. These properties have made Apidaecin a potential novel antibiotic drug1.
The mechanism of action of Apidaecin starts with the binding of the peptides to the outer membrane of bacteria. This binding is followed by the invasion of the periplasmic space, and by an irreversible combination with a receptor/docking molecule, component of a permease-type transporter system on inner membrane drug3. In our project, this mechanism of action suggested the use of Apidaecin as an alternative treatment against two diseases that affect Honeybee larvae, the American and European foulbrood.
Sequence and Features
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 86
- 1000COMPATIBLE WITH RFC[1000]
References
1. Casteels, P., Ampe, C., Jacobs, F., Vaeck, M., & Tempst, P. (1989). Apidaecins: antibacterial peptides from honeybees. The EMBO Journal, 8(8), 2387–2391.
2. Mishra, A., Choi, J., Moon, E., & Baek, K.-H. (2018). Tryptophan-Rich and Proline-Rich Antimicrobial Peptides. Molecules, 23(4), 815. https://doi.org/10.3390/molecules23040815
3. Wei-Fenm L., Guo-Xia, M., & Xu-Xia, Z. (2006). Apidaecin-type peptides: Biodiversity, structure–function relationships and mode of action. National Institute for Biotechnology Information. DOI: 10.1016/j.peptides.2006.03.016