Difference between revisions of "Part:BBa K2834006"
Zazilibt17 (Talk | contribs) |
Zazilibt17 (Talk | contribs) |
||
| Line 5: | Line 5: | ||
<p align="justify"> | <p align="justify"> | ||
| − | This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, abaecin, a 6x His-Tag and a T1 terminator from E. coli. This composite enables the expression of abaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination. | + | This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, abaecin, a 6x His-Tag and a T1 terminator from E. coli. This composite enables the expression of abaecin in <i>E. coli</i> BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of <i>E. coli</i> promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination. |
<br> | <br> | ||
</p> | </p> | ||
<p align="justify"> | <p align="justify"> | ||
| − | + | As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, abaecin and the His-tag. The exact synthesized sequence is:<br> | |
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTCCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAA AGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC | TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTCCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAA AGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC | ||
</p> | </p> | ||
| Line 22: | Line 22: | ||
The antimicrobial effect of peptides, and their production, has been studied in the immunological system of animals, such as bees. These peptides were directly extracted from the animal’s hemolymph, which were purified and tested in bacterial culture, presenting antimicrobial activity<sup>3</sup>. | The antimicrobial effect of peptides, and their production, has been studied in the immunological system of animals, such as bees. These peptides were directly extracted from the animal’s hemolymph, which were purified and tested in bacterial culture, presenting antimicrobial activity<sup>3</sup>. | ||
<br><br> | <br><br> | ||
| − | Recently, four families of AMPs (i.e., apidaecins, abaecin, hymenoptaecin and defensins) have been described in the honey bee<sup>2</sup>. The abaecin peptide, found in Apis mellifera, is one of the largest proline-rich antimicrobial peptide, with 34 amino acids containing 10 prolines (29%) and no cysteine residues. Prolines are uniformly distributed through the peptide length, preventing the α-helical conformation<sup>3</sup>. Abaecin inhibits growth of G+ bacteria. The abaecin precursor was found both in adult bees and in bee brood hemolymph. Expression and abundance of abaecin is rapidly up-regulated in response to bacterial infection, there is a time-dependent increase in expression of this peptide in first-instar larvae after P. larvae spores exposure<sup>2</sup>. In our project, abaecin is expressed in E. coli BL21 (DE3) to be used against the bacteria that cause American and European Foulbrood.<br><br> | + | Recently, four families of AMPs (i.e., apidaecins, abaecin, hymenoptaecin and defensins) have been described in the honey bee<sup>2</sup>. The abaecin peptide, found in <i>Apis mellifera</i>, is one of the largest proline-rich antimicrobial peptide, with 34 amino acids containing 10 prolines (29%) and no cysteine residues. Prolines are uniformly distributed through the peptide length, preventing the α-helical conformation<sup>3</sup>. Abaecin inhibits growth of G+ bacteria. The abaecin precursor was found both in adult bees and in bee brood hemolymph. Expression and abundance of abaecin is rapidly up-regulated in response to bacterial infection, there is a time-dependent increase in expression of this peptide in first-instar larvae after P. larvae spores exposure<sup>2</sup>. In our project, abaecin is expressed in <i>E. coli BL21</i> (DE3) to be used against the bacteria that cause American and European Foulbrood.<br><br> |
</p> | </p> | ||
Revision as of 00:52, 14 October 2018
Expressible abaecin antimicrobial peptide from Apis mellifera
This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, abaecin, a 6x His-Tag and a T1 terminator from E. coli. This composite enables the expression of abaecin in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-Tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, abaecin and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCC CGTGTCCGGCGTCCAGTATACATTCCGCAGCCACGCCCGCCCCACCCGAGGCTCCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAA AGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC
Usage and Biology
Antimicrobial peptides (AMPs) are oligopeptides with a varying number (from five to over a hundred) of amino acids that have a broad spectrum of targeted organisms ranging from viruses to parasites1. AMPs are molecules present in the immune system of multinuclear organisms, acting in the defense against invaders such as gram-positive, gram-negative bacteria and fungi3.
The antimicrobial effect of peptides, and their production, has been studied in the immunological system of animals, such as bees. These peptides were directly extracted from the animal’s hemolymph, which were purified and tested in bacterial culture, presenting antimicrobial activity3.
Recently, four families of AMPs (i.e., apidaecins, abaecin, hymenoptaecin and defensins) have been described in the honey bee2. The abaecin peptide, found in Apis mellifera, is one of the largest proline-rich antimicrobial peptide, with 34 amino acids containing 10 prolines (29%) and no cysteine residues. Prolines are uniformly distributed through the peptide length, preventing the α-helical conformation3. Abaecin inhibits growth of G+ bacteria. The abaecin precursor was found both in adult bees and in bee brood hemolymph. Expression and abundance of abaecin is rapidly up-regulated in response to bacterial infection, there is a time-dependent increase in expression of this peptide in first-instar larvae after P. larvae spores exposure2. In our project, abaecin is expressed in E. coli BL21 (DE3) to be used against the bacteria that cause American and European Foulbrood.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 86
- 1000COMPATIBLE WITH RFC[1000]
References
1. Bahar, A., & Ren, D. (2013). Antimicrobial Peptides. Pharmaceuticals, 6(12), 1543–1575. doi.org/10.3390/ph6121543
2. Danihlík, J., Aronstein, K., & Petřivalský, M. (2015). Antimicrobial peptides: a key component of honey bee innate immunity. Journal of Apicultural Research, 54(2), 123–136. doi:10.1080/00218839.2015.1109919
3.Prudencio, D., Franco, J., Goulart, L., Nicolau, N. & Ueira, C. (2017). Heterologous expression of abaecin peptide from Apis mellifera in Pichia pastoris. Microbial Cell Factories. doi.org/10.1186/s12934-017-0689-6