Difference between revisions of "Part:BBa K2834005"
Line 5: | Line 5: | ||
<p align="justify"> | <p align="justify"> | ||
Expressible defensin 2 antimicrobial peptide from Apis mellifera | Expressible defensin 2 antimicrobial peptide from Apis mellifera | ||
− | This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, | + | This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, defensin 1 honey bee antimicrobial peptide, a 6x His-tag, and a T1 terminator from E. coli. This composite enables the expression of defensin 1 in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination. |
</p> | </p> |
Revision as of 23:58, 13 October 2018
Expressible defensin 1 antimicrobial peptide from Apis mellifera
Expressible defensin 2 antimicrobial peptide from Apis mellifera This BioBrick™ counts with a T7 promoter + RBS, a pelB leader sequence, defensin 1 honey bee antimicrobial peptide, a 6x His-tag, and a T1 terminator from E. coli. This composite enables the expression of defensin 1 in E. coli BL21 (DE3). The IPTG-inducible promoter controls the expression of the T7 polymerase gene in E. coli BL21 (DE3), later T7 polymerase can synthesize large quantities of RNA from a DNA sequence cloned downstream of the T7 promoter due to its high processivity and transcription frequency. The pelB leader sequence directs the protein to the periplasmic membrane of E. coli promoting the correct folding of proteins and reducing the formation of inclusion bodies. The His-tag consists of six histidine residues that are used to purify the recombinant protein, and finally, the T1 terminator is employed to provide efficient transcription termination.
As this composite includes coding regions for fusion peptides, scars are not part of the sequence between pelB, defensin 1 and the His-tag. The exact synthesized sequence is:
TAATACGACTCACTATAGGGAAAGAGGAGAAATACTAGATGAAATACCTGCTGCCGACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCCAT
GGTAACTTGTGACCTTCTCTCATTCAAAGGACAAGTTAATGACAGTGCTTGCGCTGCTAACTGTCTCAGTTTGGGTAAAGCTGGAGGTCATTGCGAGAAAGGAGTTT
GTATTTGTCGAAAAACCAGTTTCAAAGATCTCTGGGACAAACGTTTCGGTCATCACCATCACCATCACTGATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAG TCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 233
- 23COMPATIBLE WITH RFC[23]
- 25INCOMPATIBLE WITH RFC[25]Illegal NgoMIV site found at 86
- 1000COMPATIBLE WITH RFC[1000]