Difference between revisions of "Part:BBa K2591021"

 
Line 3: Line 3:
 
<partinfo>BBa_K2591021 short</partinfo>
 
<partinfo>BBa_K2591021 short</partinfo>
  
−
Single-gRNA is a small RNA which help CRISRR-Cas protein family to target the exogenous sequence, and assist the prokaryotes to defend phages. Nowadays, the artificial gRNA can achieve the modification casually in the gene level and is a excellent way to introduce mutation. In our project, we design this gRNA for wntless WNT ligand secretion mediator (Wls), and it is a functional protein for the secretion of the Wnt3A protein and assist the modification for the mature Wnt3A protein. Therefore, if we use the gRNA for Wls, we can inhibit the donor cell to secret the Wnt3A protein normally.
 
  
−
<!-- Add more about the biology of this part here
 
 
===Usage and Biology===
 
===Usage and Biology===
 +
 +
Naturally, single guide RNA(sgRNA) is a small RNA which guide CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in the gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013) 
 +
 +
 +
 +
Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc., 2013) 
 +
 +
 +
 +
In our project, we design this gRNA for wntless WNT ligand secretion mediator (Wls), and it is a functional protein for the secretion of the Wnt3A protein and assist the modification for the mature Wnt3A protein. Therefore, if we use the gRNA for Wls, we can inhibit the donor cell to secret the Wnt3A protein normally.(Fig2)
 +
 +
 +
Figure2. Diagram of pSB1C3_gRNA_scaffold.
 +
 +
 +
===Characterization===
 +
 +
length: 20 nt
 +
 +
target sequence: TGACAAGATCCGTGACATCG
 +
 +
primer for plasmid construction:
 +
 +
Wls-gRNA-F 5' -CACCGTGACAAGATCCGTGACATCG- 3'
 +
 +
Wls-gRNA-R 5' -AAACCGATGTCACGGATCTTGTCAC- 3'
 +
 +
Location in gene loci:
 +
 +
 +
As mentioned above, knockout of Wls will impair the Wnt3a secretion activity in the cells. Therefore, we first introduce sgWls into L-Wnt3A-Cas9-mCherry cell line, which continuously expresses Cas9 protein. And then coculture with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence after one day to validate our part. Validation images are shown in Fig3.
 +
 +
 +
 +
Figure 4. 293R-TCF-EGFP cell line coculture with the L-Wnt3A-Cas9-mCherry-gRNA_Wls cell line in 24h. (a) observe with white light; (b) observe at 475nm; (c) observe at 556nm. We cannot see green fluorescent protein at the 475nm, it means the Wnt3A protein cannot be secreted from the L cell normally, and the gRNA designed for Wls could target specific sequence and mutate it with Cas9 protein.
 +
 +
  
 
<!-- -->
 
<!-- -->

Revision as of 17:53, 11 October 2018


A gRNA designed to Wls, an essential gene to secretion of the canonical wnt protein


Usage and Biology

Naturally, single guide RNA(sgRNA) is a small RNA which guide CRISRR-Cas protein family to target the exogenous sequence in prokaryotes, and assists them to defend phages. Nowadays, the artificial CRISPR-Cas9 system can achieve the modification casually in the gene level and is an excellent way to introduce mutation. The mechanism is shown in Fig1, the Cas9 nuclease is targeted to genomic DNA by a sgRNA consisting of a 20-nt guide sequence (blue) and a scaffold (red). The guide sequence pairs with the DNA target (blue bar on top strand), directly upstream of a require a 5’-NGG adjacent motif (PAM; pink). Cas9 mediates a double strand break in the upstream of the PAM (red triangle).(Ran, et al, Nat. Protoc., 2013)


Figure1. Schematic of the RNA-guided Cas9 nuclease.(Ran, et al, Nat. Protoc., 2013)


In our project, we design this gRNA for wntless WNT ligand secretion mediator (Wls), and it is a functional protein for the secretion of the Wnt3A protein and assist the modification for the mature Wnt3A protein. Therefore, if we use the gRNA for Wls, we can inhibit the donor cell to secret the Wnt3A protein normally.(Fig2)


Figure2. Diagram of pSB1C3_gRNA_scaffold.


Characterization

length: 20 nt

target sequence: TGACAAGATCCGTGACATCG

primer for plasmid construction:

Wls-gRNA-F 5' -CACCGTGACAAGATCCGTGACATCG- 3'

Wls-gRNA-R 5' -AAACCGATGTCACGGATCTTGTCAC- 3'

Location in gene loci:


As mentioned above, knockout of Wls will impair the Wnt3a secretion activity in the cells. Therefore, we first introduce sgWls into L-Wnt3A-Cas9-mCherry cell line, which continuously expresses Cas9 protein. And then coculture with our Wnt3a reception cell, 293R-TCF-EGFP cell, then observed the fluorescence after one day to validate our part. Validation images are shown in Fig3.


Figure 4. 293R-TCF-EGFP cell line coculture with the L-Wnt3A-Cas9-mCherry-gRNA_Wls cell line in 24h. (a) observe with white light; (b) observe at 475nm; (c) observe at 556nm. We cannot see green fluorescent protein at the 475nm, it means the Wnt3A protein cannot be secreted from the L cell normally, and the gRNA designed for Wls could target specific sequence and mutate it with Cas9 protein.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]