Difference between revisions of "Part:BBa K2878001"

Line 11: Line 11:
 
==Biology==
 
==Biology==
 
Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA.  
 
Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA.  
<br><br>
+
<br>
 
The target site for ARK-shRNA-1 on the Arginine Kinase mRNA is 997- 1018 after AUG. Arginine kinase participates in arginine metabolism, transferring phosphorus group from ATP to arginine. When gene for Arginine Kinase is silenced, phylotreta striolata is killed.<br><br>
 
The target site for ARK-shRNA-1 on the Arginine Kinase mRNA is 997- 1018 after AUG. Arginine kinase participates in arginine metabolism, transferring phosphorus group from ATP to arginine. When gene for Arginine Kinase is silenced, phylotreta striolata is killed.<br><br>
 
<!-- -->
 
<!-- -->

Revision as of 13:03, 9 October 2018


ARK-shRNA-1 template sequence

This DNA oligo is ARK-shRNA-1 transcription template (GGAGTTCGATGCCGTTAAGGAGTTCGTTGTCCTTAACGGCATCGAACTCCTT),We use this template for ARK-shRNA-1 generation through in vitro transcription system. ARK-shRNA-1 is designed to silence Phyllotreta striolata Arginine Kinase gene, the target site on the Arginine Kinase mRNA is 997-1018 after AUG.

Usage

In our project, ARK-shRNA-1 was used to silence Arginine Kinase gene of phylotreta striolata. ARK-shRNA-1 solution (10ng/ml) can be sprayed on leaves of cruciferous plants, ingestion of the ARK-shRNA-1 by P. striolata will induce the RNAi mechanism in the insect and lead to its death.

Biology

Eukaryotic organisms including insects possess this RNAi mechanism for sequence-specific gene silencing that is triggered by the introduction of double-stranded RNA (dsRNA). Once introduced into the cell, the dsRNA is cleaved into small interfering RNA (siRNA) by an enzyme called Dicer, producing multiple siRNAs. One strand of each siRNA is loaded into Argonaute, an endonuclease, to form an RNA-induced Silencing Complex (RISC), and guiding the RISC to the target mRNA, resulting in the effective cleavage and subsequent degradation of the target mRNA. RNAi mechanism can be triggered by introducing either dsRNA, siRNA or shRNA.
The target site for ARK-shRNA-1 on the Arginine Kinase mRNA is 997- 1018 after AUG. Arginine kinase participates in arginine metabolism, transferring phosphorus group from ATP to arginine. When gene for Arginine Kinase is silenced, phylotreta striolata is killed.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]