Difference between revisions of "Part:BBa K2560007:Design"

(Source)
(Design Notes)
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
The sequence was obtained from part BBa_J23100. The part was created by annealing single stranded oligonucleotides and subsequent integration into the part entry vector (BBa_K2560002) using Golden Gate assembly.
+
The sequence was obtained from part BBa_J23100.
  
 
===Source===
 
===Source===

Revision as of 08:26, 25 September 2018


Status: 500 Content-type: text/html

Software error:

Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 252.
Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 253, at end of line
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 253, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 263, near "= @_"
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 284, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 288, near "= @_"
Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 290.
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 316, near "}"
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.


Status: 500 Content-type: text/html

Software error:

Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 252.
Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 253, at end of line
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 253, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 263, near "= @_"
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 284, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 288, near "= @_"
Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 290.
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 316, near "}"
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.


Design Notes

The sequence was obtained from part BBa_J23100.

Source

Forward Oligo: CTCGGGAGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTACT

Reverse Oligo: CTCAAGTAGCTAGCACTGTACCTAGGACTGAGCTAGCCGTCAACTCC

References