Difference between revisions of "Part:BBa K2629001:Design"
Line 22: Line 22:
 
<center>5’ – ACCACCCGCACGGCGACA<font color="red">T</font>CGCGGTCTAC<font color="red">A</font>ACACCATCGTGC – 3'  </center>
 
<center>5’ – ACCACCCGCACGGCGACA<font color="red">T</font>CGCGGTCTAC<font color="red">A</font>ACACCATCGTGC – 3'  </center>
  
 +
<h3> 1.b. Design of the probe</h3>
 +
<p>The probe aims to receive the target, by binding by perfect complementarity. It is made by : <br>
 +
→ Two restrictions enzymes producing cohesives and, <font color=" #00FFFF">SphI</font> and <font color=" #00FFFF">NgoMIV</font>, which goal  is to remove the little sequence in between on the bottom strand and thus create a perfect complementarity with the target.  But at the end we trust that using PCR linearization could reduce the background of uncut plasmid. <br>
 +
→ Twi nicking enzymes, <font color="green">Nt.BspQ1</font> and <font color="green">Nb.BssS1</font>, enzymes that cut one strand of the double DNA strand.  Thereby, the top strand is removed, allowing the binding of the target.</p><br>
  
 +
PHOTOT
  
 +
<p><center>Probe :  </center><br>
 +
 +
<h3>1.c. Choice of the plasmid backbone</h3>
 +
 +
<p>We chose a plasmid from the iGEM 2018 DNA distribution kit, following different conditions to screen. We wanted the plasmid to :<br>
 +
→ have a red fluorescent reporter: RFP or mCherry <br>
 +
→ high level copy <br>
 +
→ properly sequenced  <br>
 +
→ have no restriction sites that were used for the probe <br>
 +
→ not be arabinose inducible (the first tests we did were not conclusive) so preference for IPTG induction <br>
 +
 +
<center>https://static.igem.org/mediawiki/parts/4/44/T--grenoble-alpes--carte_J04450.png</center><br>
 +
 +
Finally, we chose BBa_J04450 as an original backbone for this part. This iGEM part enables users to produce the reporter mRFP1, a fluorophore which is an engineered mutant of red fluorescent protein from Discosoma striata. Its reporter is LacI sensitive and can be induced with IPTG.</p>
 +
<h3>1.d. New part : BBa_K2629000</h3>
 +
 +
<p>Then, the part we designed is made with two parts : the detector, i.e. the probe and the plasmid backbone, carrying a reporter.  <br>
 +
To sum up, once the probe is activated/digested, a “window” is opened: a short part of the detector is single strand, allowing the ligation of the target by complementarity and then the recircularization of the plasmid, which can be transformed.</p>
  
  

Revision as of 09:46, 12 September 2018

The goal of our detector is to reveal the presence one resistance marker of Pseudomonas aeruginosa in a sample after a specific lysis by a bacteriophage. The design of this detector has been inspired by Cork Ireland 2015 team : they created different based on the perfect complementarity of the double strand DNA.
Thus, we - Grenoble team 2018 - decided to create a similar detector of one resistance marker of Pseudomonas aeruginosa pathogen.

1. Bioinformatics Part

1.a. Choice of the target

The detection of bacterial resistance marker will be done by detecting a gene fragment.
Pyo has developed many resistance mechanisms during evolution. The most common mechanisms are multiple mutations leading to AmpC overexpression (ceftazidime), oprD inactivation (meropenem), modification of type II topoisomerases, as well as overexpression of the efflux pump (ciprofloxacin and meropenem) [1].
By doing some reading, we selected the gene that mutated most and looked for common mutations on it. The selected gene was gyrA gene (2772 bp). It encodes for the DNA gyrase subunit A (topoisomerase II) and is on the PA3168 genome PA3168 locus. The gyrase DNA mutation leads to resistance to fluoroquinolones [2] [3]. Fluoroquinolones are antibiotics acting on DNA gyrase, it prevents replication of bacterial DNA and thus bacterial proliferation.
We noticed in several articles explaining the mutations of the gyrA (GenBank: AAG06556.1) gene of Pyo clinical strains, that some were redundant. First, at position 83 of the gyrA gene, threonine becomes an isoleucine (Thr83Ile) [2] [3] [4]. Moreover, in position 87 an aspartate becomes an asparagine (Asp87Asn) [2] [4] [5]. So we decided to work on these two mutations. The advantage is that they are close in the gyrA gene (12 nucleotides between them), this is an important point because the detection target sequence must not exceed 100 nucleotides. Once the location was found, the gene mutated was inserted in NebCutter to see restriction sites.
Finally, a sequence alignment in BLAST was performed to ensure that the fragment was only found in Pyo.
The target is located between nucleotide 229 and nucleotide 721 of GyrA gene.

Target : antibiotic resistance of biologically selected PAO1 (Red: mutations):
5’ – ACCACCCGCACGGCGACATCGCGGTCTACAACACCATCGTGC – 3'

1.b. Design of the probe

<p>The probe aims to receive the target, by binding by perfect complementarity. It is made by :
→ Two restrictions enzymes producing cohesives and, SphI and NgoMIV, which goal is to remove the little sequence in between on the bottom strand and thus create a perfect complementarity with the target. But at the end we trust that using PCR linearization could reduce the background of uncut plasmid.

→ Twi nicking enzymes, Nt.BspQ1 and Nb.BssS1, enzymes that cut one strand of the double DNA strand. Thereby, the top strand is removed, allowing the binding of the target.


PHOTOT

Probe :

1.c. Choice of the plasmid backbone

<p>We chose a plasmid from the iGEM 2018 DNA distribution kit, following different conditions to screen. We wanted the plasmid to :
→ have a red fluorescent reporter: RFP or mCherry
→ high level copy
→ properly sequenced
→ have no restriction sites that were used for the probe
→ not be arabinose inducible (the first tests we did were not conclusive) so preference for IPTG induction

T--grenoble-alpes--carte_J04450.png

Finally, we chose BBa_J04450 as an original backbone for this part. This iGEM part enables users to produce the reporter mRFP1, a fluorophore which is an engineered mutant of red fluorescent protein from Discosoma striata. Its reporter is LacI sensitive and can be induced with IPTG.

1.d. New part : BBa_K2629000

Then, the part we designed is made with two parts : the detector, i.e. the probe and the plasmid backbone, carrying a reporter.
To sum up, once the probe is activated/digested, a “window” is opened: a short part of the detector is single strand, allowing the ligation of the target by complementarity and then the recircularization of the plasmid, which can be transformed.





Design Notes

The probe is designed in order to detect a fragment less than 100 bp. The aim is to create a single strand window that enable the perfect hybridization of our choosen target. It is made by: → Two restrictions enzymes producing cohesives end, SphI and NgoMIV, which goal is to remove the little sequence in between on the bottom strand and thus create a perfect complementarity with the target. But at the end we trust that using PCR linearization could reduce the background of uncut plasmid. → Twi nicking enzymes, Nt.BspQ1 and Nb.BssS1, enzymes that cut one strand of the double DNA strand.



Source

The aim is to detect a small fragment of Pseudomonas aeruginosa DNA. The target was found in GyrA gene (2772 bp) from PAO1 strain (GenBank : AAG06556.1) located in PA3168 locus. The target is located between nucleotide 229 and nucleotide 721. GyrA is found in all Pseudomonas aeruginosa strains and not linked in pathogenic behavior of Pseudomonas aeruginosa.


References

[1] Evolution of Pseudomonas aeruginosa Antimicrobial Resistance and Fitness under Low and High Mutation Rates, Gabriel Cabot, Antimicrobial Agents and Chemotherapy, Volume 60 Number 3, March 2016 </p>

[2] Type II topoisomerase mutations in fluoroquinolone-resistant clinical strains of Pseudomonas aeruginosa isolated in 1998 and 1999 : role of target enzyme in mechanism of fluoroquinolone resistance, Akasaka T, Antimicrobial Agents and Chemotherapy, 45(8) : 2263-8, 2001 August

[3] Type II topoisomerase mutations in ciprofloxacin-resistant strains of Pseudomonas aeruginosa, Mouneimné H, Antimicrobial Agents and Chemotherapy, 43 (1) : 62-6, 1999 January

[4] GyrA mutations in ciprofloxacin-resistant clinical isolates of Pseudomonas aeruginosa in a Silesian Hospital in Poland, Wydmuch Z, Polish Journal of Microbiology, 54 (3) : 201-6, 2005

[5] The role og gyrA and parC mutations in fluoroquinolones-resistant Pseudomonas aeruginosa isolates from Iran, Braz Journal Microbiol, 47 (4) : 925-930, 2016 Oct-Dec