Difference between revisions of "Part:BBa K2524011:Design"

Line 13: Line 13:
  
 
The GST tag also allowed for affinity gravity column chromatography purification. In fact, the HRV-3 protease site made cleavage of Mambalgin-1 from the GST tag possible in our lab (we don’t have access to FPLC).  
 
The GST tag also allowed for affinity gravity column chromatography purification. In fact, the HRV-3 protease site made cleavage of Mambalgin-1 from the GST tag possible in our lab (we don’t have access to FPLC).  
 
+
<html>
  
 
Uniprot research of Mambalgin-1 protein conducted:
 
Uniprot research of Mambalgin-1 protein conducted:
Line 20: Line 20:
  
 
<b>The construct was submitted to IDT in minigene format.</b>
 
<b>The construct was submitted to IDT in minigene format.</b>
<ul><b>Results</b>:<table><tr><td>[[https://static.igem.org/mediawiki/2017/6/69/T--Georgia_State--Mamba_IDT.png|thumb]]</td></tr></table>
+
<ul><b>Results</b>:<table><tr><td><img width="50%" height="50%" src="https://static.igem.org/mediawiki/2017/6/69/T--Georgia_State--Mamba_IDT.png"></td></tr></table>
  
  

Revision as of 03:56, 2 November 2017


Mambalgin-1 in E. coli Improvement


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 763
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 160


Design Notes

To improve our previous Mambalgin-1 part

We improved our previous Mambalgin-1 construct (https://parts.igem.org/Part:BBa_K1110003) for E. coli this year by removing extra base pairs that coded for a portion of the signal peptide segment. The new sequence produces the Mambalgin-1 protein without any signal peptide. Next, we added a TAC promoter, LAC operon, GST-Tag, and an HRV-3 protease site upstream of the Mambalgin-1 coding sequence. This increased the size of our target protein by 26 kDa, which made protein band detection much easier on SDS PAGE. Subsequently, the strategy solved our issues related to losing our protein band in the SDS PAGE dye-front.

The GST tag also allowed for affinity gravity column chromatography purification. In fact, the HRV-3 protease site made cleavage of Mambalgin-1 from the GST tag possible in our lab (we don’t have access to FPLC). Uniprot research of Mambalgin-1 protein conducted: - Determined functional portion of protein sequence --> trim down unnecessary amino acids - Original protein sequence contains an initial signal sequence which was not included The construct was submitted to IDT in minigene format.

    Results:
    Primers were designed to add restriction sites in order to remove the sequence from the plasmid. Mamba EcoRI Forward TCTAAGAATTCATGCTGAAATGTTACCAACATGG Mamba NotI Reverse ATTATGCGGCCGCCTATTTGTTGCATCTGTCTGTTGAG The restriction sites made the sequence compatible for insertion into the PGEX 6p-3t backbone. PCR to create official biobrick prefix site proximal to Tac promoter Mamba Add XbaI Forward GCAATATCTAGAGTTGACAATTAATCATCGGCTCG Mamba add SpeI & PstI Reverse CTGCAGCGGCCGCTACTAGTACTATTTGTTGCATCTGTCTGTTG Generator part into PSB1C3 Mutagenesis to remove second EcoRI site upstream of Mamba CDS EcoRI Mutagen Forward-sense CCCTGGGATCCCCGAATCCGATGCTGAAATGT EcoRI Mutagen Antisense ACATTTCAGCATCGGATTCGGGGATCCCAGGG Protein Expression Protein purification - GST sepharose 4B resin Column protease cleavage with HRV-3 protease -> elute pure Mambalgin-1 afterward Protein Detection - western blot with monoclonal Anti-GST antibodies f ===Source=== Protein sequence from UNIPROT NCBI Blast ===References===