Difference between revisions of "Part:BBa K2322005"
WangYingkun (Talk | contribs) |
WangYingkun (Talk | contribs) |
||
Line 3: | Line 3: | ||
<partinfo>BBa_K2322005 short</partinfo> | <partinfo>BBa_K2322005 short</partinfo> | ||
− | + | [[File:2017CIEICHINA005.png|center|500px|img]] | |
This circuit contains a AOX1 promoter, a ribosome binding site, a gltB gene. This circuit is used to test the expression of gltB. If the circuit work, the gltB will express normally in GS115. | This circuit contains a AOX1 promoter, a ribosome binding site, a gltB gene. This circuit is used to test the expression of gltB. If the circuit work, the gltB will express normally in GS115. |
Revision as of 14:21, 1 November 2017
-AOX1 promoter-RBS-gltB-
This circuit contains a AOX1 promoter, a ribosome binding site, a gltB gene. This circuit is used to test the expression of gltB. If the circuit work, the gltB will express normally in GS115.
AOX1 promoter: Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of gltB, our targeted gene.
RBS (Ribosome Binding Site): A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.Sequence: TCACACAGGAAACA gltB Escherichia coli glutamate acid synthase gene (gltB) is found in the Escherichia coli. Saccharomyces cerevisiae glutamate acid-6-phosphate synthase (GltB ) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.
Figure1: The image of Escherichia coli glutamate acid.
It is assumed that gltB can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the glutamate acid. The changing in the expression of gltB can positively affect the amount of glutamate acid in the cell. Glutamate is a key compound in cellular metabolism. It is a metabolic fuel.
A key process in amino acid degradation is transamination, in which the amino group of an amino acid is transferred to an α-ketoacid, typically catalyzed. So during a osmotic high environment, with the induced in the certain condition, it will increase the rate of the metabolism.
Primer of this part AOX-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT Glt-B-RP: TGACACCTTGCCCTTTTTTGCCGGACTGCAGTTAAACAAATGGTGCAGCATCATGC
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1
Illegal BamHI site found at 938 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1480