Difference between revisions of "Part:BBa K2322003"

Line 9: Line 9:
 
This circuit is used to test the expression of ScTPS1. If the circuit work, the ScTPS1 will express extracellular in GS115.
 
This circuit is used to test the expression of ScTPS1. If the circuit work, the ScTPS1 will express extracellular in GS115.
 
AOX1 promoter:  
 
AOX1 promoter:  
Sequence of the primer:
 
ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT
 
 
Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of ScTPS1, our targeted gene.   
 
Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of ScTPS1, our targeted gene.   
  
Line 30: Line 28:
 
With more ScTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether ScTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.
 
With more ScTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether ScTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.
  
 +
Primer of this part:
 +
AOX-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT
 +
Glt-B-RP: TGACACCTTGCCCTTTTTTGCCGGACTGCAGTTAAACAAATGGTGCAGCATCATGC
  
耐盐图
+
 
 +
When the salinity of the environment is lower than 2%, the difference of survivability between the original GS115 and the GS115 containing ScTPS1 is not apparent. When the salinity of the environment is higher than 2%, the GS115 containing ScTPS1 has a remarkably higher survivability.
 +
[[File:Tutututu.png|center|380px|img]]
 
Figure 2: The figure shows the survivability  results of the GS115 along with the ScTPS1 contained GS115. 1 is GS115, 2 is ScTPS1 for extracellular expression, and 3 is ScTPS1 for intracellular expression.
 
Figure 2: The figure shows the survivability  results of the GS115 along with the ScTPS1 contained GS115. 1 is GS115, 2 is ScTPS1 for extracellular expression, and 3 is ScTPS1 for intracellular expression.
  

Revision as of 12:10, 1 November 2017


-AOX1 promoter-S-RBS-ScTPS1-

Part%E7%94%A8No.5.png

The circuit contain AOX1 promoter, the secretion signal, RBS, ScTPS1 and terminator.

This circuit is used to test the expression of ScTPS1. If the circuit work, the ScTPS1 will express extracellular in GS115. AOX1 promoter: Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of ScTPS1, our targeted gene.

Secretion signal: Secretion signal is to prompt a cell to translocate the protein, in this case, the protein that induced by ScTPS1 can express extracellular. And in this circuit, after collecting the protein that express outside, we can determine the ScTPS1’s function as a qualitatively way.

RBS (Ribosome Binding Site): A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.Sequence: TCACACAGGAAACA

ScTPS1: Saccharomyces cerevisiae trehalose-6-phosphate synthase (ScTPS1) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.

Part%E7%94%A8No.2.png Figure1: The image of Schizosaccharomyces pombe.

It is assumed that ScTPS1 can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the trehalose. The changing in the expression of ScTPS1 can positively affect the amount of trehalose in the cell. Trehalose, as a small molecules substance, can increase the cell’s ability of regulating the osmotic pressure. When the osmotic pressure from the environment is too high, the cell will face the dangerous of dehydration or plasmolysis. Trehalose can turn into a gel phase when the cells are dehydrated. The gel phase sugar can prevents the further disruption of internal cell organelles, because the gel can splinting the cell organelles in position.

With more ScTPS1 expressed, there will be more trehalose in our targeted cell, GS115. We plan to transform this part in the GS115, and test GS115 in different controlled environment. By testing this, we can test whether ScTPS1 will have the same effect in GS115 and whether it can affect the surviving rate of GS115. Then we plan to test the performance of GS115 after transformation in the process of degradation of food waste.

Primer of this part: AOX-FP: ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT Glt-B-RP: TGACACCTTGCCCTTTTTTGCCGGACTGCAGTTAAACAAATGGTGCAGCATCATGC


When the salinity of the environment is lower than 2%, the difference of survivability between the original GS115 and the GS115 containing ScTPS1 is not apparent. When the salinity of the environment is higher than 2%, the GS115 containing ScTPS1 has a remarkably higher survivability.

img

Figure 2: The figure shows the survivability results of the GS115 along with the ScTPS1 contained GS115. 1 is GS115, 2 is ScTPS1 for extracellular expression, and 3 is ScTPS1 for intracellular expression.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1
    Illegal BamHI site found at 938
    Illegal XhoI site found at 1192
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]