Difference between revisions of "Part:BBa K2322005"

Line 6: Line 6:
  
 
This circuit contains a AOX1 promoter, a ribosome binding site, a gltB gene, and a terminator. This circuit is used to test the expression of gltB. If the circuit work, the gltB will express normally in GS115.
 
This circuit contains a AOX1 promoter, a ribosome binding site, a gltB gene, and a terminator. This circuit is used to test the expression of gltB. If the circuit work, the gltB will express normally in GS115.
 
 
Name: BBa_K2322005
 
 
  
 
AOX1 promoter:  
 
AOX1 promoter:  
 
Sequence of the primer:
 
ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT
 
 
 
Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of gltB, our targeted gene.   
 
Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of gltB, our targeted gene.   
 
  
 
RBS (Ribosome Binding Site):  
 
RBS (Ribosome Binding Site):  
A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.
+
A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.Sequence: TCACACAGGAAACA
  
Sequence: TCACACAGGAAACA
 
  
  
 +
gltB
 +
Escherichia coli glutamate acid synthase gene (gltB) is found in the Escherichia coli.
 +
Saccharomyces cerevisiae glutamate acid-6-phosphate synthase (GltB ) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.
  
gltB
+
https://static.igem.org/mediawiki/parts/e/e2/Part%E7%94%A8No.7.png   
 +
Figure1: The image of Escherichia coli glutamate acid.
 +
 
 +
It is assumed that gltB can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the glutamate acid. The changing in the expression of gltB can positively affect the amount of glutamate acid in the cell.
 +
Glutamate is a key compound in cellular metabolism. It is a metabolic fuel. A key process in amino acid degradation is transamination, in which the amino group of an amino acid is transferred to an α-ketoacid, typically catalyzed.
 +
R1-amino acid + R2-α-ketoacid ⇌ R1-α-ketoacid + R2-amino acid
 +
Alanine + α-ketoglutarate ⇌ pyruvate + glutamate
 +
Aspartate + α-ketoglutarate ⇌ oxaloacetate + glutamate
 +
So during a osmotic high environment, with the induced in the certain condition, it will increase the rate of the metabolism.
  
Sequence:
 
  
AACACACCTTATGACAGTCAGGAATTGACTGTTTCTCTAACGACTTCCCTTTTAGCCTTAAAGATAAAATCCA
 
TTTTAATTTCAGTCATTTAATAAAGAATTTTGCGCTAAAGCACATTTCTGTACCAATAAGCTTGCCATTTGAC
 
CTGTATCAGCTTTCCCGATAAGTTGGAAATCCGCTGGAAGCTTTCTGGATGAGCAGCCTGCTCATCATATTTA
 
TGCAGTAATTGAGATCCCCTCTTCACCGTATTAACCGATGCGAAAAGGACAACAAGGGGGCGAATCGGAGGCG
 
CGCGTATGACACGCAAACCCCGTCGCCACGCTCTTTCTGTGCCCGTGCGCAGCGGTTCGGAAGTGGGGTTCCC
 
GCAGAGCCTGGGGGAGGTTCACGATATGTTGTACGATAAATCCCTTGAGAGGGATAACTGTGGTTTCGGCCTG
 
ATCGCCCACATAGAAGGCGAACCTAGCCACAAGGTAGTGCGTACTGCAATACACGCACTGGCCCGCATGCAGC
 
ACCGTGGCGCGATTCTCGCCGATGGTAAAACCGGCGACGGTTGCGGCTTGCTGTTACAAAAACCGGATCGCTT
 
TTTTCGCATCGTTGCGCAGGAGCGCGGCTGGCGTTTAGCAAAAAACTACGCTGTCGGGATGCTCTTCCTGAAT
 
AAAGATCCTGAACTCGCCGCTGCCGCACGCCGCATCGTTGAAGAAGAACTGCAACGCGAAACCTTGTCGATTG
 
TGGGCTGGCGTGATGTCCCCACTAACGAAGGCGTGCTGGGTGAAATCGCCCTCTCCTCTCTGCCACGCATTGA
 
GCAAATTTTTGTGAACGCCCCGGCAGGCTGGCGTCCACGCGATATGGAGCGCCGTCTGTTTATCGCCCGCCGC
 
CGCATTGAAAAGCGTCTCGAAGCCGACAAAGACTTCTACGTCTGTAGCCTGTCGAATCTGGTGAACATCTATA
 
AAGGTCTGTGTATGCCGACGGATCTGCCGCGCTTTTATCTGGATCTTGCGGACCTGCGTCTGGAATCGGCCAT
 
TTGCCTGTTCCACCAGCGCTTCTCCACTAACACCGTACCGCGCTGGCCGTGGCGCAACCGTTCCGCTATCTGG
 
CGCATAACGGTGAAATCAACACCATCACCGGTAACCGCCAATGGGCGTGCGCGTACTTATAAATTCCAGACAC
 
CGCTTATCCCTGACCTGCACGACGCCGCACCGTTCGTC
 
  
Terminator:
 
  
Sequence of the primer:
 
TGACACCTTGCCCTTTTTTGCCGGACTGCAGTTAAGAAGAAGAGTTCATAGACAAAAC
 
  
 
Function: The terminator is used to control the expression of our targeted gene, gltB.  
 
Function: The terminator is used to control the expression of our targeted gene, gltB.  

Revision as of 10:54, 1 November 2017


-AOX1 promoter-RBS-gltB-

%E6%96%B0%E7%9A%84.png

This circuit contains a AOX1 promoter, a ribosome binding site, a gltB gene, and a terminator. This circuit is used to test the expression of gltB. If the circuit work, the gltB will express normally in GS115.

AOX1 promoter: Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of gltB, our targeted gene.

RBS (Ribosome Binding Site): A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.Sequence: TCACACAGGAAACA


gltB Escherichia coli glutamate acid synthase gene (gltB) is found in the Escherichia coli. Saccharomyces cerevisiae glutamate acid-6-phosphate synthase (GltB ) is found in the Schizosaccharomyces pombe. The Schizosaccharomyces pombe a species of yeast used in traditional brewing and as a common model in synthetic biology. It is belong to the Schizosaccharomycetes class, and Schizosaccharomycetaceae family.

Part%E7%94%A8No.7.png Figure1: The image of Escherichia coli glutamate acid.

It is assumed that gltB can enhance the osmotic pressure tolerance of the Schizosaccharomyces pombe, because it is the essential gene in the synthesis of the glutamate acid. The changing in the expression of gltB can positively affect the amount of glutamate acid in the cell. Glutamate is a key compound in cellular metabolism. It is a metabolic fuel. A key process in amino acid degradation is transamination, in which the amino group of an amino acid is transferred to an α-ketoacid, typically catalyzed. R1-amino acid + R2-α-ketoacid ⇌ R1-α-ketoacid + R2-amino acid Alanine + α-ketoglutarate ⇌ pyruvate + glutamate Aspartate + α-ketoglutarate ⇌ oxaloacetate + glutamate So during a osmotic high environment, with the induced in the certain condition, it will increase the rate of the metabolism.



Function: The terminator is used to control the expression of our targeted gene, gltB.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 1
    Illegal BamHI site found at 938
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI.rc site found at 1480