Difference between revisions of "Part:BBa K2319005:Design"
Raj Magesh (Talk | contribs) (→Design Notes) |
Raj Magesh (Talk | contribs) (→Design Notes) |
||
Line 7: | Line 7: | ||
===Design Notes=== | ===Design Notes=== | ||
+ | <html> | ||
<p><a href="https://parts.igem.org/Part:BBa_J18932">BBa_J18932</a> (mCherry RFP) has an interesting flaw: an internal ATG near the N-terminus has a RBS-like sequence preceding it; this hidden translation start site leads to ~50% truncation of the produced mCherry protein!</p> | <p><a href="https://parts.igem.org/Part:BBa_J18932">BBa_J18932</a> (mCherry RFP) has an interesting flaw: an internal ATG near the N-terminus has a RBS-like sequence preceding it; this hidden translation start site leads to ~50% truncation of the produced mCherry protein!</p> | ||
Line 17: | Line 18: | ||
<p>By exploiting a natural NdeI site (CA\TATG) occurring right after the modified sequence, we insert <a href="https://parts.igem.org/Part:BBa_K2319006">BBa_K2319006</a> comprising a HindIII site (for insertion into the T7 expression backbone), a start codon (ATG), and a 6xHis-tag (for easy Ni-NTA column-based protein purification), and the modified sequence preceding the hidden translation start site.</p> | <p>By exploiting a natural NdeI site (CA\TATG) occurring right after the modified sequence, we insert <a href="https://parts.igem.org/Part:BBa_K2319006">BBa_K2319006</a> comprising a HindIII site (for insertion into the T7 expression backbone), a start codon (ATG), and a 6xHis-tag (for easy Ni-NTA column-based protein purification), and the modified sequence preceding the hidden translation start site.</p> | ||
+ | </html> | ||
===Source=== | ===Source=== |
Revision as of 10:21, 1 November 2017
mCherry-SpyTag under T7 expression system
- 10COMPATIBLE WITH RFC[10]
- 12INCOMPATIBLE WITH RFC[12]Illegal NheI site found at 828
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 765
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
BBa_J18932 (mCherry RFP) has an interesting flaw: an internal ATG near the N-terminus has a RBS-like sequence preceding it; this hidden translation start site leads to ~50% truncation of the produced mCherry protein!
Our First Modification — Improved mCherry
Using an in silico analysis of RBS strengths using an online RBS Calculator, we modified the nucleotide sequence preceding the translation start site to become a far weaker RBS while maintaining the same amino acid sequence. This inhibits translation initiation at that position by almost 75% (predicted) and so reduces the truncation of the protein.
BBa_J18932_mCherry 1 GTGAGCAAAGGCGAGGAAGATAACATG 27 |||...|||||.||.||||||||.||| Improved_mCherry 1 GTGTCTAAAGGTGAAGAAGATAATATG 27
By exploiting a natural NdeI site (CA\TATG) occurring right after the modified sequence, we insert BBa_K2319006 comprising a HindIII site (for insertion into the T7 expression backbone), a start codon (ATG), and a 6xHis-tag (for easy Ni-NTA column-based protein purification), and the modified sequence preceding the hidden translation start site.
Source
This was assembled using existing BioBricks and some custom oligos to add specific sequences.