Difference between revisions of "Part:BBa K2281005"

Revision as of 09:23, 1 November 2017

--ScOYE--

Introduction

LOCUS NM_001179310

SIZE 1203 bp

DEFINITION Saccharomyces cerevisiae S288c NADPH dehydrogenase (OYE2).

ScOYE stands for Saccharomyces cerevisiae Old Yellow Enzyme which is the reductase which bolsters the production of cireonellol from geraniol.

The diagram shows the complete pathway of the production of citronellol and OYE is emplyed in the final step of the process.

胶图

primer: ScOYE-Ecor1-F:CGGAATTCATGCCATTTGTTAAGG

ScOYE1-R-PstI,ACCTTGCCCTTTTTTGCCGGACTTAATTTTTGTCCCAACCG

From the diagram above we can see gene OYE has been ligated to the vector properly.

Source

SOURCE Saccharomyces cerevisiae S288C

Saccharomyces cerevisiae is a species of yeast. It has been instrumental to winemaking, baking, and brewing since ancient times. It is believed to have been originally isolated from the skin of grapes (one can see the yeast as a component of the thin white film on the skins of some dark-colored fruits such as plums; it exists among the waxes of the cuticle). It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology, much like Escherichia coli as the model bacterium. It is the microorganism behind the most common type of fermentation. S. cerevisiae cells are round to ovoid, 5–10 μm in diameter. It reproduces by a division process known as budding

 ORGANISM  Saccharomyces cerevisiae S288C
           Eukaryota; Fungi; Dikarya; Ascomycota; Saccharomycotina;
           Saccharomycetes; Saccharomycetales; Saccharomycetaceae;
           Saccharomyces.

References

REFERENCE 1 (bases 1 to 1203)

 AUTHORS   Goffeau,A., Barrell,B.G., Bussey,H., Davis,R.W., Dujon,B.,
           Feldmann,H., Galibert,F., Hoheisel,J.D., Jacq,C., Johnston,M.,
           Louis,E.J., Mewes,H.W., Murakami,Y., Philippsen,P., Tettelin,H. and
           Oliver,S.G.
 TITLE     Life with 6000 genes
 JOURNAL   Science 274 (5287), 546 (1996)
  PUBMED   8849441

REFERENCE 2 (bases 1 to 1203)

 AUTHORS   Johnston,M., Andrews,S., Brinkman,R., Cooper,J., Ding,H., Dover,J.,
           Du,Z., Favello,A., Fulton,L., Gattung,S. et al.
 TITLE     Complete nucleotide sequence of Saccharomyces cerevisiae chromosome
           VIII
 JOURNAL   Science 265 (5181), 2077-2082 (1994)
  PUBMED   8091229

Sequence and Features