Difference between revisions of "Part:BBa K2273107:Design"
Line 6: Line 6:
  
 
===Design Notes===
 
===Design Notes===
−
As stated on the main page of this part, we aimed for an easy cloning and screening procedure in our cloning host <i>Escherichia coli</i>. To accomplish that, we chose to set the construct RFPsyn2 as placeholder for the N-terminally fused protein and the gene <i>lacZα</i> for the C-terminally fused protein, respectively. Therefore, the blue color of <i>lacZα</i> carrying colonies and thereby X-Gal degrading colonies masks the red color of the RFPsyn2 on X-Gal containing agar plates (Figure 1, A). However, on not X-Gal containing agar plates, the red color of the RFPsyn2 will be visible. This applies to colonies not carrying <i>lacZα</i>, too (Figure 1, B). <i>E. coli</i> colonies carrying neither <i>lacZα</i> nor RPFsyn2 will stay whitish as common <i>E. coli</i> colonies (Figure 1, C). By applying this setup, successfully transformed <i>E. coli</i> colonies can be identified easily.
+
As stated on the main page of this part, we aimed for an easy cloning and screening procedure in our cloning host <i>Escherichia coli</i>. To accomplish that, we chose to set the construct RFPsyn2 as placeholder for the N-terminally fused protein and the gene <i>lacZα</i> for the C-terminally fused protein, respectively.<br><br>
−
 
+
Therefore, the blue color of <i>lacZα</i> carrying colonies and thereby X-Gal degrading colonies masks the red color of the RFPsyn2 on X-Gal containing agar plates (Figure 1, A). However, on not X-Gal containing agar plates, the red color of the RFPsyn2 will be visible. This applies to colonies not carrying <i>lacZα</i>, too (Figure 1, B). <i>E. coli</i> colonies carrying neither <i>lacZα</i> nor RPFsyn2 will stay whitish as common <i>E. coli</i> colonies (Figure 1, C). By applying this setup, successfully transformed <i>E. coli</i> colonies can be identified easily.<br><br>
−
 
+
−
 
+
 
===Source===
 
===Source===
−
 
+
The vector pSB1C3 was cut with EcoRI and XbaI to insert the xylose inducible promoter P<sub><i>xylA</i></sub> (Radeck et al., 2013) which was prior amplified wich was prior amplified using the following set of primers:
−
tba
+
<table>
 +
<tr>
 +
<td width="150">iG17P051</td>
 +
<td>gatcgaattcgcggccgcttctagagaaggccaaaaaactgctgcc</td>
 +
</tr>
 +
<tr>
 +
<td>iG17P052</td>
 +
<td>gatcgctagcgagaccttcgataagcttgggatccc</td>
 +
</tr>
 +
</table><br>
 +
Following the amplification, we digested the PCR product with EcoRI and BsaI (resulting in an XbaI overhang) to maintain the BioBrick prefix in front of the promoter.followed by digestion with EcoRI and BsaI (resulting in an XbaI overhang) to maintain the BioBrick prefix in front of the promoter.
  
 
===References===
 
===References===

Revision as of 16:45, 31 October 2017

Evaluation Vector with PxylA to screen for protein specific secretion efficiency


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BamHI site found at 247
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 1354
    Illegal AgeI site found at 1348
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 266


Design Notes

As stated on the main page of this part, we aimed for an easy cloning and screening procedure in our cloning host Escherichia coli. To accomplish that, we chose to set the construct RFPsyn2 as placeholder for the N-terminally fused protein and the gene lacZα for the C-terminally fused protein, respectively.

Therefore, the blue color of lacZα carrying colonies and thereby X-Gal degrading colonies masks the red color of the RFPsyn2 on X-Gal containing agar plates (Figure 1, A). However, on not X-Gal containing agar plates, the red color of the RFPsyn2 will be visible. This applies to colonies not carrying lacZα, too (Figure 1, B). E. coli colonies carrying neither lacZα nor RPFsyn2 will stay whitish as common E. coli colonies (Figure 1, C). By applying this setup, successfully transformed E. coli colonies can be identified easily.

Source

The vector pSB1C3 was cut with EcoRI and XbaI to insert the xylose inducible promoter PxylA (Radeck et al., 2013) which was prior amplified wich was prior amplified using the following set of primers:

iG17P051 gatcgaattcgcggccgcttctagagaaggccaaaaaactgctgcc
iG17P052 gatcgctagcgagaccttcgataagcttgggatccc

Following the amplification, we digested the PCR product with EcoRI and BsaI (resulting in an XbaI overhang) to maintain the BioBrick prefix in front of the promoter.followed by digestion with EcoRI and BsaI (resulting in an XbaI overhang) to maintain the BioBrick prefix in front of the promoter.

References