Difference between revisions of "Part:BBa K2322006"
Line 3: | Line 3: | ||
<partinfo>BBa_K2322006 short</partinfo> | <partinfo>BBa_K2322006 short</partinfo> | ||
− | + | https://static.igem.org/mediawiki/parts/3/33/Part%E7%94%A8No.o.png | |
+ | |||
+ | The circuit contain AOX1 promoter, the secretion signal, RBS, gltB and terminator. This circuit is used to test the expression of gltB. | ||
+ | If the circuit works, the gltB will express extracellular in GS115. | ||
+ | |||
+ | Name: BBa_K2322006 | ||
+ | |||
+ | AOX1 promoter: | ||
+ | |||
+ | Sequence of the primer: | ||
+ | |||
+ | ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT | ||
+ | |||
+ | Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of gltB, our targeted gene. | ||
+ | |||
+ | |||
+ | |||
+ | Secretion signal: | ||
+ | |||
+ | Secretion signal is to prompt a cell to translocate the protein, in this case, the protein that induced by gltB can express extracellular. And in this circuit, after collecting the protein that express outside, we can determine the gltB’s function as a qualitatively way. | ||
+ | |||
+ | |||
+ | |||
+ | RBS (Ribosome Binding Site): | ||
+ | A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation. | ||
+ | |||
+ | Sequence: TCACACAGGAAACA | ||
+ | |||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here |
Revision as of 16:20, 31 October 2017
-AOX1 promoter-S-RBS-gltB-terminater-
The circuit contain AOX1 promoter, the secretion signal, RBS, gltB and terminator. This circuit is used to test the expression of gltB. If the circuit works, the gltB will express extracellular in GS115.
Name: BBa_K2322006
AOX1 promoter:
Sequence of the primer:
ATGATTTCTGGAATTCGCGGCCGCTTCTAGAGATCTAACATCCAAAGACGAAAGGT
Function: AOX1 is a strong promoter in the pichia pastoris. It is highly effective. It can be restricted by glucose, glycerinum, ethyl alcohol. It can be induced by the methanol. In our experiment, our circuit is in an environment containing methanol. In this circuit, it is used to control and increase the expression of gltB, our targeted gene.
Secretion signal:
Secretion signal is to prompt a cell to translocate the protein, in this case, the protein that induced by gltB can express extracellular. And in this circuit, after collecting the protein that express outside, we can determine the gltB’s function as a qualitatively way.
RBS (Ribosome Binding Site): A ribosome binding site is a sequence of mRNA. It is used to make sure the ribosome is on the correct position of the mRNA at the beginning of the translation.
Sequence: TCACACAGGAAACA
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 1
Illegal BamHI site found at 938
Illegal XhoI site found at 1192 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI.rc site found at 1764