Difference between revisions of "Part:BBa K2273111"
Line 40: Line 40:
 
     </figure>
 
     </figure>
 
</html>
 
</html>
 +
<p></p>
 +
<p>For the creation of our biosensor in <i>B. subtilis</i>, the <i>bla</i>-operon from <i>S. aureus</i> was split into three genetic constructs: <b>(A)</b> The Receptor gene <i>blaR1</i> under control of a strong constitutive promotor (P<sub><i>veg</i></sub>), <b>(B)</b> the Repressor gene blaI under control moderate strong constitutive promoter (P<sub><i>lepA</i></sub>) and <b>(C)</b> the target promoter region of the <i>bla</i>-operon (P<sub><i>blaZ</i></sub> and P<sub><i>blaR1I</i></sub>) in front of the <i>lux</i>-operon (<i>luxABCDE</i>). In addition, an inducible version of the <i>blaR1</i> construct was made by inserting the P<sub><i>xylA</i></sub> promoter upstream of the <i>blaR1</i> gene <b>(A)</b>.<a target="_blank" href ="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942778/">[5]</a></p>
 +
  
−
<!-- Uncomment this to enable Functional Parameter display
 
 
===Functional Parameters===
 
===Functional Parameters===
 
<partinfo>BBa_K2273111 parameters</partinfo>
 
<partinfo>BBa_K2273111 parameters</partinfo>
 
<!-- -->
 
<!-- -->

Revision as of 18:57, 30 October 2017


PblaZ Promoter controlling gene expression of blaZ in S. aureus

The PblaZ promoter is a part used in the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].

This part is a composite of the bla operon found in Staphylococcus aureus and constitutes the promoter regulating gene expression of the gene blaZ, coding for a beta-lactamase. If the microorganism is exposed to beta-lactam antibiotics, a receptor, named blaR1 [1], senses the compound and a signal is transduced into the cytoplasm. Subsequently, the BlaI repressor protein [2] is degraded and frees the PblaZ promoter. Following, the blaZ gene is transcribed and confers resistance to the antibiotic.

This part features the RFC10 prefix and suffix:

Prefix with EcoRI, NotI, XbaI GAATTCGCGGCCGCTTCTAGA
Suffix with SpeI, NotI and PstI ACTAGTAGCGGCCGCTGCAGA

Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red)

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]

Beta-Lactam Biosensor

Worldwide, multidrug-resistant bacteria are on the rise and provoke the intensive search for novel effective compounds. To simplify the search for new antibiotics and to track the antibiotic pollution in water samples, whole-cell biosensors constitute a helpful investigative tool. In this part of EncaBcillus, we developed a functional and independent heterologous Beta-lactam biosensor in Bacillus subtilis. These specialised cells are capable of sensing a compound of the beta-lactam family and will respond by the production of an easily measurable luminescence signal. We analysed the detection range and sensitivity of the biosensor in response to six different Beta-lactam antibiotics from various subclasses. The evaluated biosensor was then encapsulated into Peptidosomes to proof the concept of our project EncaBcillus. The encapsulation of engineered bacteria allows an simplified handling and increased biosafety, potentially raising the chances for their application in e.g. sewage treatment plants.

Design of the Biosensor

To achieve our goal of encapsulating bacteria into Peptidosomes that can sense antibiotics of the beta-lactam family, we first needed to develop a reliable biosensor strain. In Staphylococcus aureus the bla-operon encodes a one-component system, which is responsible for sensing and mediating resistance against beta-lactam antibiotics. The idea was to transfer the regulatory elements of this operon to Bacillus subtilis and replace the native output – being the beta-lactamase BlaZ – by an easy detectable signal. Thus, making Bacillus subtilis a beta-lactam sensing biosensor. (see Figure 2).

Figure 2: Overall concept showing the components and the molecular mechanism of the biosensor in B. subtilis.Upon binding of a beta-lactam to the receptor BlaR1 (1), due to the receptors c-terminal proteolytic activity, the repressor BlaI is degraded and frees the target promoter (2) enabling the expression of an easy detectable reporter (3).

For the creation of our biosensor in B. subtilis, the bla-operon from S. aureus was split into three genetic constructs: (A) The Receptor gene blaR1 under control of a strong constitutive promotor (Pveg), (B) the Repressor gene blaI under control moderate strong constitutive promoter (PlepA) and (C) the target promoter region of the bla-operon (PblaZ and PblaR1I) in front of the lux-operon (luxABCDE). In addition, an inducible version of the blaR1 construct was made by inserting the PxylA promoter upstream of the blaR1 gene (A).<a target="_blank" href ="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2942778/">[5]</a>


Functional Parameters