Difference between revisions of "Part:BBa K2323002"
Line 10: Line 10:
  
 
<h2>Usage and Biology</h2>
 
<h2>Usage and Biology</h2>
−
The (+)-strand RNA genomes are often translated by the host to polyprotein precursors, which are then co-translationally cleaved by therefore provided proteases into the mature proteins. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV).
+
The Tobacco Etch Virus (TEV) protease is a cysteine protease with high specificity towards its target sequence. Along with other two proteins in the Tobacco Etch Virus, it has the function to cleave the polyprotein that is produced after translating the whole (+)-stran RNA genome of the virus. In addition, the natural TEV protease contains its own target sequence and thus cleaves itself, reducing its activity over time.
−
For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins [http://www.jbc.org/content/277/52/50564.long].
+
For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognises the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. This target sequence is uncommon in natural proteins, allowing the in-vivo expression and use of TEV protease without a toxic side-effect caused by unwanted cleavage of host proteins. To avoid the autolysis, TEV protease is usually used with a single S219V point mutation to make the cleavage site unrecognisable for the protein.  
−
 
+
−
For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the Biobrick [https://parts.igem.org/Part:BBa_K1319008 BBa_K1319008] by adding a 6x His-tag, which made it possible to purify this protease.  
+
  
 
[[File:BBa_K2323002_Plasmid_Map.svg| frame | 400px | center | The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.]]
 
[[File:BBa_K2323002_Plasmid_Map.svg| frame | 400px | center | The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.]]

Revision as of 19:39, 29 October 2017


TEV protease with N-terminal 6x His-Tag under the control of the pT7 promoter

Introduction

TEV protease is a highly specific cysteine protease from the Tobacco Etch Virus. An improvement over BBa_K1319008, the protease can be expressed in strains with T7-polymerase and then purified with the help of the His-TAg for synthetic in-vitro circuits.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 71
    Illegal AgeI site found at 803
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage and Biology

The Tobacco Etch Virus (TEV) protease is a cysteine protease with high specificity towards its target sequence. Along with other two proteins in the Tobacco Etch Virus, it has the function to cleave the polyprotein that is produced after translating the whole (+)-stran RNA genome of the virus. In addition, the natural TEV protease contains its own target sequence and thus cleaves itself, reducing its activity over time. For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognises the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. This target sequence is uncommon in natural proteins, allowing the in-vivo expression and use of TEV protease without a toxic side-effect caused by unwanted cleavage of host proteins. To avoid the autolysis, TEV protease is usually used with a single S219V point mutation to make the cleavage site unrecognisable for the protein.

Error creating thumbnail: File missing
The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.


Cloning, expression and Purification

The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.

Name 5'-3' primers sequences
p-TEV-His-fwd catcatcaccatcaccacgccggcggcgaaagc
p-TEV-His-rev catctagtatttctcctctttctctagtatctccc
Gel of the Overhang PCR

After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5α for plasmid storage and E. coli BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.


Error creating thumbnail: File missing
Affinity purification of His-TEV using the Äkta protein purification system.
  • 10 % SDS-PAGE of affinity purification of the His-TEV protease

  • Affinity

  • Affinity

Error creating thumbnail: File missing
Size exclusion chromatography of TEV protease
10% SDS-PAGE of size exclusion chromatography.

For an activity test, we incubated 30 µg His-MBP-Cas13a-Lsh as substrate with 1 µg of our TEV protease. We inactivated the cleavage reaction by adding 1x SDS-loading buffer. We analyzed the reaction with a SDS-PAGE and loaded samples, which were incubated 0, 1, 2, 3, 4 ,5 and overnight. The gel shows that nearly all our substrate is already cleaved after 1 h into His-MBP and Cas13a-Lsh.

TEV-protease activity assay