Difference between revisions of "Part:BBa K2323002"

Line 40: Line 40:
 
[[Image:BBa_K2323002_His_TEV.svg | thumb | center | 600px | Affinity purification of His-TEV using the Äkta protein purification system.]]
 
[[Image:BBa_K2323002_His_TEV.svg | thumb | center | 600px | Affinity purification of His-TEV using the Äkta protein purification system.]]
  
[[Image:BBa_K2323002_His_TEV_PAGE_2.png | thumb | right | 400px | Affinity purification of His-TEV using the Äkta protein purification system.]]
+
[[Image:BBa_K2323002_His_TEV_PAGE_2.png | thumb | left | 400px | Affinity purification of His-TEV using the Äkta protein purification system.]]
  
[[Image:BBa_K2323002_His_TEV_PAGE_1.png | thumb | left | 400px | Affinity purification of His-TEV using the Äkta protein purification system.]]
+
[[Image:BBa_K2323002_His_TEV_PAGE_1.png | thumb | right | 400px | Affinity purification of His-TEV using the Äkta protein purification system.]]
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here

Revision as of 15:34, 29 October 2017


TEV protease with N-terminal 6x His-Tag under the control of the pT7 promoter

Introduction

TEV protease is a highly specific cysteine protease from the Tobacco Etch Virus. An improvement over BBa_K1319008, the protease can be expressed in strains with T7-polymerase and then purified with the help of the His-TAg for synthetic in-vitro circuits.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 71
    Illegal AgeI site found at 803
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage and Biology

The (+)-strand RNA genomes are often translated by the host to polyprotein precursors, which are then co-translationally cleaved by therefore provided proteases into the mature proteins. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV). For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins [http://www.jbc.org/content/277/52/50564.long].

For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the Biobrick BBa_K1319008 by adding a 6x His-tag, which made it possible to purify this protease.

Error creating thumbnail: File missing
The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.


Cloning, expression and Purification

The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.

Name 5'-3' primers sequences
p-TEV-His-fwd catcatcaccatcaccacgccggcggcgaaagc
p-TEV-His-rev catctagtatttctcctctttctctagtatctccc
Gel of the Overhang PCR

After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5&alpha for plasmid storage and E. coli BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.


Error creating thumbnail: File missing
Affinity purification of His-TEV using the Äkta protein purification system.
Affinity purification of His-TEV using the Äkta protein purification system.
Affinity purification of His-TEV using the Äkta protein purification system.