Difference between revisions of "Part:BBa K2323002"
Line 31: Line 31:
 
|-
 
|-
 
|}
 
|}
−
After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> DH5&alpha for plasmid storage and <i>E. coli</i> BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.
 
  
 +
<p align="justify">
 +
After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in <i>E. coli</i> DH5&alpha for plasmid storage and <i>E. coli</i> BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.
 +
</p>
  
  

Revision as of 15:17, 29 October 2017


TEV protease with N-terminal 6x His-Tag under the control of the pT7 promoter

Introduction

TEV protease is a highly specific cysteine protease from the Tobacco Etch Virus. An improvement over BBa_K1319008, the protease can be expressed in strains with T7-polymerase and then purified with the help of the His-TAg for synthetic in-vitro circuits.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 71
    Illegal AgeI site found at 803
  • 1000
    COMPATIBLE WITH RFC[1000]

Usage and Biology

The (+)-strand RNA genomes are often translated by the host to polyprotein precursors, which are then co-translationally cleaved by therefore provided proteases into the mature proteins. One of these proteases was found in the plant pathogenic Tobacco Etch Virus (TEV). For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins [http://www.jbc.org/content/277/52/50564.long].

For scientists the TEV protease is a molecular tool to cleave of all sorts of protein tags precisely due to its sequence specificity. It recognizes the amino acid sequence Glu-Asn-Leu-Tyr-Gln-Ser and cleaves then between glutamic acid and serine. In our project, the TEV protease is a main component in the Intein-Extein readout, but also was used in the purification procedure of our Cas13a proteins. We improved the Biobrick BBa_K1319008 by adding a 6x His-tag, which made it possible to purify this protease.

Error creating thumbnail: File missing
The TEV plasmid map shows the binding sites of the overhang primers. Indicated are also coding sequence, terminator, T7 promotor and RBS.


Cloning, expression and Purification

The His-tag was added to pSB1C3-BBa-K1319008 by PCR with overhang primers p-TEV-His-fwd and p-TEV-His-rev.

Name 5'-3' primers sequences
p-TEV-His-fwd catcatcaccatcaccacgccggcggcgaaagc
p-TEV-His-rev catctagtatttctcctctttctctagtatctccc

After PCR we ligated the plasmid using the T4 ligase. This sample was then transformed in E. coli DH5&alpha for plasmid storage and E. coli BL21star for protein expression. We expressed the TEV protease in 2xYT medium and purified it via affinity and size exclusion chromatography.


Figure 1: Fermentation of E. coli KRXwith BBa_K863005 (ECOL) in an Infors Labfors Bioreactor, scale: 3 L, [http://2012.igem.org/Team:Bielefeld-Germany/Protocols/Materials#Autoinduction_medium autoinduction medium] + 60 µg/mL chloramphenicol, 37 °C, pH 7, agitation on cascade to hold pO2 at 50 %, OD600 measured every 30 minutes.