Difference between revisions of "Part:BBa K2382004"
Line 1: Line 1:
−
 
 
__NOTOC__
 
__NOTOC__
 
<partinfo>BBa_K2382004 short</partinfo>
 
<partinfo>BBa_K2382004 short</partinfo>
  
−
This part previously functioned as a DNA recombination and repair protein
 
−
in E. coli. It is also found that Thioredoxin is capable of increasing the
 
−
solubility of our protein, MSMEG5998. Therefore, we create this part for
 
−
future igem teams who want to make their protein more soluble when
 
−
facing inclusion bodies in E. coli.
 
  
 
<!-- Add more about the biology of this part here
 
<!-- Add more about the biology of this part here
 
===Usage and Biology===
 
===Usage and Biology===
−
 
 
<!-- -->
 
<!-- -->
−
<span class='h3bb'>Sequence and Features</span>
+
 
 +
===<span class='h3bb'>Sequence and Features</span>===
 
<partinfo>BBa_K2382004 SequenceAndFeatures</partinfo>
 
<partinfo>BBa_K2382004 SequenceAndFeatures</partinfo>
  
Line 21: Line 15:
 
<partinfo>BBa_K2382004 parameters</partinfo>
 
<partinfo>BBa_K2382004 parameters</partinfo>
 
<!-- -->
 
<!-- -->
−
===Design Notes===
+
 
−
Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active.And we remove the stop coden of Thioredoxin
+
 
−
(NC_000913.3) so that it can be used in fusion protein designing.
+
===Usage and Biology===
−
We Insert linker between our two proteins: thioredoxine and MSMEG5998.
+
This part previously functioned as a DNA recombination and repair protein
−
The purpose is to separate these two proteins
+
in E. coli. It is also found that Thioredoxin is capable of increasing the
−
The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT,
+
solubility of our protein, MSMEG5998. Therefore, we create this part for
−
There are four restriction site in it:
+
future igem teams who want to make their protein more soluble when
−
Kpn1:GGT’ACC
+
facing inclusion bodies in E. coli.
−
Sma1: CCC’GGG
+
 
−
BamH1:GGA’TCC
+
===Characterization of the Thioredoxin with polylinker===
−
Xho1:C’TCGAG
+
 
−
The last of the sequence plus two glycine, and it allow the protein behind linker can be reversed, reducing the probability of protein folding error.
+
===References===

Revision as of 12:12, 29 October 2017

Status: 500 Content-type: text/html

Software error:

Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 252.
Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 253, at end of line
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 253, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 263, near "= @_"
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 284, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 288, near "= @_"
Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 290.
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 316, near "}"
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.



Sequence and Features

Status: 500 Content-type: text/html

Software error:

Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 252.
Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 253, at end of line
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 253, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 263, near "= @_"
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 284, near "}"
Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 288, near "= @_"
Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 290.
syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 316, near "}"
Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16.
Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.

For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.



Usage and Biology

This part previously functioned as a DNA recombination and repair protein in E. coli. It is also found that Thioredoxin is capable of increasing the solubility of our protein, MSMEG5998. Therefore, we create this part for future igem teams who want to make their protein more soluble when facing inclusion bodies in E. coli.

Characterization of the Thioredoxin with polylinker

References