Difference between revisions of "Part:BBa K2281005"

Revision as of 09:57, 28 October 2017

--ScOYE--

Introduction

T7-promoter-F primer: TAATACGACTCACTATAGGG T7-terminator-R primer:

Description: When ligated with T7 promoter, lacI operator, RBS and T7 terminator, HbOYE can express properly in E. Coli. The part includes a strong ribosomal binding site. Its strength was determined by cloning it in front of mRFP1 reporter and measuring fluorescence of BL21 cells containing a low copy number plasmid containing the report.

T7 Promoter primer: a strong primer that can express at any time, any cell under any circumstance, so it motivates the expression of HbOYE. lacI operator: a lactose opteron consisting promoter and other cis-acting elements. In this part, lacI operator is regulated by T7 promoter. To make lacI operator function, inductor IPTG is added.

HbOYE: LOCUS DQ004685 SIZE 1455 bp DEFINITION Hevea brasiliensis 12-oxophytodienoate reductase (opr).

Experiments

HbOYE stands for Hevea brasiliensis Old Yellow Enzyme which functions as a reductase. In our experiment, HbOYE bolsters the production of cireonellol from geraniol. Our goal is to combine OYE gene with GES to create an integrated pathway. The pathway will make glucose experience MVA and DXP pathway to be Geranyl diphosphate and then transform into citronellol directly. Therefore, the synthesis of citronellol can be more efficient than ever. In the experiment, we utilize electrophoresis to check whether the properties of real material is the same as the theoretical one. Only if they are perfectly match, we can perform the latter experiments successfully.

胶图

As the picture shown above, the size of the XXX is XXX, so we are one step closer to our success.

From Zeng’s research showed that different OYE gene in E.coli and yeast can induce different production of citronellol. Thus, in this part, we choose HbOYE to perform the experiment.

In the later step, we are going to construct two plasmids，one contain GES gene, and the other one contain OYE genes, the two plasmids can be transform to one cell. Finally, we will obtain our target product---citronellol.

Referrence

Ying ZENG et al. ‘Identification of enzymes responsible for the reduction of geraniol to Citronellol’. DOI 10.1007/s13659-011-0032-6

Gareth Norton et al.. ‘Characterisation of recombinant Hevea brasiliensis allene oxide synthase: Effects of cycloxygenase inhibitors, lipoxygenase inhibitors and salicylates on enzyme activity’. Plant Physiology and Biochemistry 45 (2007) 129-138.

Zeng Ying et al. ‘Identification of Enzymes Responsible for the Reduction of Geraniol to Citronellol’. Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, 650201

Sequence and Features