Difference between revisions of "Part:BBa K2382003"
LeeWeiYang (Talk | contribs) |
LeeWeiYang (Talk | contribs) |
||
Line 19: | Line 19: | ||
===Design Notes=== | ===Design Notes=== | ||
We use the T7 promotor from Part:BBa_K525998(Group: iGEM11_Bielefeld-Germany (2011-09-13)) | We use the T7 promotor from Part:BBa_K525998(Group: iGEM11_Bielefeld-Germany (2011-09-13)) | ||
− | > | + | >sequence (32 bp) |
taatacgactcactatagggaaagaggagaaa | taatacgactcactatagggaaagaggagaaa | ||
We add additional sequence on it. There are two function in our sequence follow the T7 promotor. One is lac operator, the other is RBS binding site. | We add additional sequence on it. There are two function in our sequence follow the T7 promotor. One is lac operator, the other is RBS binding site. |
Revision as of 18:28, 27 October 2017
Status: 500
Content-type: text/html
Software error:
Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 250. Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
This part originated from pET-29 a (+) Vectors and Part:BBa_K525998. It is composed of T7 promoter, Lac operator, and RBS.
Sequence and Features
Status: 500
Content-type: text/html
Software error:
Global symbol "$range" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 250. Unmatched right curly bracket at /websites/parts.igem.org/cgi/lib/Range.pm line 251, at end of line syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 251, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 261, near "= @_" syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 282, near "}" Can't use global @_ in "my" at /websites/parts.igem.org/cgi/lib/Range.pm line 286, near "= @_" Global symbol "$course" requires explicit package name at /websites/parts.igem.org/cgi/lib/Range.pm line 288. syntax error at /websites/parts.igem.org/cgi/lib/Range.pm line 314, near "}" Compilation failed in require at /websites/parts.igem.org/cgi/lib/Part.pm line 16. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/lib/Part.pm line 16. Compilation failed in require at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8. BEGIN failed--compilation aborted at /websites/parts.igem.org/cgi/partsdb/putout.cgi line 8.
For help, please send mail to this site's webmaster, giving this error message and the time and date of the error.
Design Notes
We use the T7 promotor from Part:BBa_K525998(Group: iGEM11_Bielefeld-Germany (2011-09-13)) >sequence (32 bp) taatacgactcactatagggaaagaggagaaa We add additional sequence on it. There are two function in our sequence follow the T7 promotor. One is lac operator, the other is RBS binding site.
Lac operator could be bound with lac repressor. It could stop the transcription to prevent making protein. Genome of E.coli has the lacI gene. It could translate the repressor to inhibit protein produced. That is, we design the lac operator into our sequence to prevent the leak of expressing protein. RBS binding site could let the ribosome attach on the mRNA sequence to produce the enzyme. These sequence is derived from pET-29a(+) sequence. Because the original part has the restriction site”Xba1”in the sequence, and the sequence of this restriction site is” TCTAGA. “ We do the single mutation to convert TC”T”AGA to TC”C”AGA . Thus, the restriction site would not be recognized by restriction enzyme and cut off. That is, it is safe to use to compose the sequence for igem.