Difference between revisions of "Part:BBa K2382004"
Herlohuang (Talk | contribs) |
LeeWeiYang (Talk | contribs) |
||
Line 21: | Line 21: | ||
<partinfo>BBa_K2382004 parameters</partinfo> | <partinfo>BBa_K2382004 parameters</partinfo> | ||
<!-- --> | <!-- --> | ||
+ | ===Design Notes=== | ||
+ | Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active.And we remove the stop coden of Thioredoxin | ||
+ | (NC_000913.3) so that it can be used in fusion protein designing. | ||
+ | We Insert linker between our two proteins: thioredoxine and MSMEG5998. | ||
+ | The purpose is to separate these two proteins | ||
+ | The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT, | ||
+ | There are four restriction site in it: | ||
+ | Kpn1:GGT’ACC | ||
+ | Sma1: CCC’GGG | ||
+ | BamH1:GGA’TCC | ||
+ | Xho1:C’TCGAG | ||
+ | The last of the sequence plus two glycine, and it allow the protein behind linker can be reversed, reducing the probability of protein folding error. |
Revision as of 18:23, 27 October 2017
Thioredoxin with polylinker
This part previously functioned as a DNA recombination and repair protein in E. coli. It is also found that Thioredoxin is capable of increasing the solubility of our protein, MSMEG5998. Therefore, we create this part for future igem teams who want to make their protein more soluble when facing inclusion bodies in E. coli.
Sequence and Features
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BamHI site found at 367
Illegal XhoI site found at 373 - 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Design Notes
Thioredoxin could help the protein folding correctly, and make the fusion proteins in soluble form that are biologically active.And we remove the stop coden of Thioredoxin (NC_000913.3) so that it can be used in fusion protein designing. We Insert linker between our two proteins: thioredoxine and MSMEG5998. The purpose is to separate these two proteins The sequence of Linker contain the polylinker ,and that is: GGTACCCGGGGATCCCTCGAGGGTGGT, There are four restriction site in it: Kpn1:GGT’ACC Sma1: CCC’GGG BamH1:GGA’TCC Xho1:C’TCGAG The last of the sequence plus two glycine, and it allow the protein behind linker can be reversed, reducing the probability of protein folding error.