Difference between revisions of "Part:BBa K2273055:Design"
| Line 1: | Line 1: | ||
| − | |||
__NOTOC__ | __NOTOC__ | ||
<partinfo>BBa_K2273055 short</partinfo> | <partinfo>BBa_K2273055 short</partinfo> | ||
| − | + | <partinfo>BBa_K2273055SequenceAndFeatures</partinfo><br> | |
| − | <partinfo> | + | ===Design=== |
| − | + | This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:<br> | |
| − | + | <table> | |
| − | === | + | <tr> |
| − | + | <td width="70">Prefix with</td> | |
| − | + | <td width="200"><span style="color:blue">EcoRI</span>, <span style="color:green">NotI</span>, <span style="color:red">XbaI</span> and <span style="color:silver">SD</span></td> | |
| − | + | <td><span style="color:blue">GAATTC</span><span style="color:green">GCGGCCGC</span>T<span style="color:red">TCTAGA</span>T<span style="color:silver">AAGGAGG</span>TCAAAA</td> | |
| − | + | </tr> | |
| + | <tr> | ||
| + | <td>Suffix with</td> | ||
| + | <td><span style="color:orange">AgeI</span>, <span style="color:red">SpeI</span>, <span style="color:green">NotI</span> and <span style="color:blue">PstI</span></td> | ||
| + | <td><span style="color:orange">ACCGGT</span><u>TAA</u>T<span style="color:red">ACTAGT</span>A<span style="color:green">GCGGCCG</span><span style="color:blue">CTGCAG</span>A</td> | ||
| + | </tr> | ||
| + | </table> | ||
| + | Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (<span style="color:blue">EcoRI</span> and <span style="color:blue">PstI</span> are marked in blue, <span style="color:green">NotI</span> in green, <span style="color:red">XbaI</span> and <span style="color:red">SpeI</span> in red and <span style="color:orange">AgeI</span> in orange. Additionally, the <span style="color:silver">Shine-Dalgarno sequence</span> is marked in silver and the stop codon is underlined.)<br><br> | ||
| + | This part was designed to meet the needs of the Signal Peptide Toolbox which was created by the [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].<br><br> | ||
===Source=== | ===Source=== | ||
| − | + | The PhoA signal peptide of <i>B. subtilis</i> alkaline phosphatase A was amplified via PCR from the <i>B. subtilis</i> wild type W168 genome using the primers listed below. | |
| − | + | <br> | |
| − | + | <table> | |
| + | <tr> | ||
| + | <td width="150">PhoA_SP fwd</td> | ||
| + | <td>gatcGAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAAATGAAAAAAATGAGTTTGTTTC</td> | ||
| + | </tr> | ||
| + | <tr> | ||
| + | <td>PhoA_SP rev</td> | ||
| + | <td>gatcTCTGCAGCGGCCGCTACTAGTAttaaccggtAGCTCCGGCAAAGATTCCAG</td> | ||
| + | </tr> | ||
| + | </table> | ||
| + | Following amplification, the signal peptide was digested using EcoRI and PstI and ligated into pSB1C3.<br><br> | ||
===References=== | ===References=== | ||
| + | Ulf Brockmeier, Michael Caspers, Roland Freudl, Alexander Jockwer, Thomas Noll and Thorsten Eggert "Systematic Screening of All Signal Peptides from <i>Bacillus subtilis</i>: A Powerful Strategy in Optimizing Heterologous Protein Secretion in Gram-positive Bacteria" Journal of Molecular Biology 362 (2006): 393-402. [https://www.ncbi.nlm.nih.gov/pubmed/16930615 PubMed]<br><br> | ||
| + | Jan Maarten van Dijl and Michael Hecker "<i>Bacillus subtilis</i>: from soil bacterium to super-secreting cell factory" Microbial Cell Factories 12:3 (2013): 1-6. [https://www.ncbi.nlm.nih.gov/pubmed/23311580 PubMed]<br><br> | ||
| + | Ling lin Fu, Zi Rong Xu, Wei Fen Li, Jiang Bing Shuai, Ping Lu, Chun Xia Hu "Protein secretion pathways in <i>Bacillus subtilis</i>: Implication for optimization heterologous protein secretion" Biotechnology Advances 25 (2007): 1-12. [https://www.ncbi.nlm.nih.gov/pubmed/16997527 PubMed] | ||
Revision as of 06:33, 29 September 2017
PhoA signal peptide of B. subtilis alkaline phosphatase A
No part name specified with partinfo tag.
Design
This part was generated in a modified version of RFC25, where a strong Shine Dalgarno Sequence (SD) is included, and has the following prefix and suffix:
| Prefix with | EcoRI, NotI, XbaI and SD | GAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAA |
| Suffix with | AgeI, SpeI, NotI and PstI | ACCGGTTAATACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red and AgeI in orange. Additionally, the Shine-Dalgarno sequence is marked in silver and the stop codon is underlined.)
This part was designed to meet the needs of the Signal Peptide Toolbox which was created by the [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].
Source
The PhoA signal peptide of B. subtilis alkaline phosphatase A was amplified via PCR from the B. subtilis wild type W168 genome using the primers listed below.
| PhoA_SP fwd | gatcGAATTCGCGGCCGCTTCTAGATAAGGAGGTCAAAAATGAAAAAAATGAGTTTGTTTC |
| PhoA_SP rev | gatcTCTGCAGCGGCCGCTACTAGTAttaaccggtAGCTCCGGCAAAGATTCCAG |
Following amplification, the signal peptide was digested using EcoRI and PstI and ligated into pSB1C3.
References
Ulf Brockmeier, Michael Caspers, Roland Freudl, Alexander Jockwer, Thomas Noll and Thorsten Eggert "Systematic Screening of All Signal Peptides from Bacillus subtilis: A Powerful Strategy in Optimizing Heterologous Protein Secretion in Gram-positive Bacteria" Journal of Molecular Biology 362 (2006): 393-402. PubMed
Jan Maarten van Dijl and Michael Hecker "Bacillus subtilis: from soil bacterium to super-secreting cell factory" Microbial Cell Factories 12:3 (2013): 1-6. PubMed
Ling lin Fu, Zi Rong Xu, Wei Fen Li, Jiang Bing Shuai, Ping Lu, Chun Xia Hu "Protein secretion pathways in Bacillus subtilis: Implication for optimization heterologous protein secretion" Biotechnology Advances 25 (2007): 1-12. PubMed