Difference between revisions of "Part:BBa K2273108"
(→Beta-Lactam Biosensor) |
|||
| Line 22: | Line 22: | ||
===Beta-Lactam Biosensor=== | ===Beta-Lactam Biosensor=== | ||
| − | + | In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in Bacillus subtilis. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous. | |
| + | |||
<!-- Add more about the biology of this part here | <!-- Add more about the biology of this part here | ||
===Usage and Biology=== | ===Usage and Biology=== | ||
This Part serves as a sensing unit of the beta-lactam biosensor. The BlaR1 receptor is able to bind various beta-lactam antibiotics. After binding of a respective ligand, a signal is transducer into the bacterial cytoplasm. This Protein therefore harbours transmembrane helices and a Penicillin Binding domain (amino acid 331-585). | This Part serves as a sensing unit of the beta-lactam biosensor. The BlaR1 receptor is able to bind various beta-lactam antibiotics. After binding of a respective ligand, a signal is transducer into the bacterial cytoplasm. This Protein therefore harbours transmembrane helices and a Penicillin Binding domain (amino acid 331-585). | ||
<!-- --> | <!-- --> | ||
Revision as of 13:40, 25 September 2017
BlaR1 Beta-Lactam Receptor derived from Staphylococcus aureus N315
The blaR1 gene is part of the Beta-Lactam Biosensor project of [http://2017.igem.org/Team:TU_Dresden iGEM Team TU Dresden 2017 (EncaBcillus - It's a trap!)].
This gene is part of the bla operon found in Staphylococcus aureus and encodes a receptor that localizes in the inner cell membrane and can bind beta-lactam antibiotics, Uniprot [http://www.uniprot.org/uniprot/P18357]).
This part has been codon optimized for expression in Bacillus subtilis using the online tool provided by IDT DNA. A Ribosome Binding Site (AGGAGG) specific for translation in Bacillus subtilis has been added upstream of the gene followed by a seven nucleotide spacer. Further the part features the RFC10 prefix and suffix:
| Prefix with | EcoRI, NotI, XbaI, RBS and spacer sequence | GAATTCGCGGCCGCTTCTAGAAGGAGGTGTCAAA |
| Suffix with | SpeI, NotI and PstI | ACTAGTAGCGGCCGCTGCAGA |
Sites of restriction enzymes generating compatible overhangs are indicated by sharing one color. (EcoRI and PstI are marked in blue, NotI in green, XbaI and SpeI in red
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
- 1000COMPATIBLE WITH RFC[1000]
Beta-Lactam Biosensor
In this subproject, we developed a functional and complete heterologous beta-lactam biosensor in Bacillus subtilis. By the time these specified cells sense a compound of the beta-lactam family, they will respond by producing a measurable luminescence signal. We further investigated the detection spectrum of the biosensor by testing different beta-lactam antibiotics from various subclasses. For increased control and easy handling of the biosensor strain during a potential field application, we demonstrate that the encapsulation of the cells into Peptidosomes is quite advantageous.