Difference between revisions of "Part:BBa K2043002"

Line 1: Line 1:
  
__NOTOC__
 
 
<partinfo>BBa_K2043002 short</partinfo>
 
<partinfo>BBa_K2043002 short</partinfo>
  
Catechol 1,2-dioxygenase with FBD1
+
This part corresponds to <b>Catechol-1,2-dioxygenase</b> fused to the Fabric Binding Domain 1 (BBa_K2043010) cloned by the Paris Bettencourt team in 2016 in the context of the Frank&Stain project. This enzymes originally comes from <i>Acinetobacter pittii</i>, which we <b>codon optimised for <i>E. coli</i></b>.<br>
 +
In order to facilitate working with this enzyme, we added a <b>His-tag</b> at the <b>C-terminal</b>. This tag allows for purification in an easier way.<br><br>
 +
The <b>Fabric Binding Domain 1</b> (FBD1) has affinity for Cotton, Linnen, Polyester, Silk and Wool. It is positively charget (+1) and it is proline rich.<br><br>
  
<!-- Add more about the biology of this part here
+
We chose to work with this enzyme because it seemed to be a good candidate for degrading Anthocyanins. Anthocyanins, the key pigments present in wine, are polyphenolic molecules that are naturally found in many plants. Our project consisted in the degradation of wine strains, and therefore enzymes with the ability to degrade polyphenolic molecules were of interest to us. <br>
===Usage and Biology===
+
In particular, Catechol-dioxygenases are good candidates because they degrade Catechol, which is structurally similar to Anthocyanins.<br><br>
  
<!-- -->
+
<b>Testing the part</b><br><br>
<span class='h3bb'>Sequence and Features</span>
+
<partinfo>ATGCCGCGGCTTCCGCCTGCTGGTGGAGGTTCGAACCGTCAACAGATTGATGCTTTGGTGAAGCAGATGAACGTAGACACCGCTAAGGGTGAAGTAGACGCTCGCGTGCAGCAAATCGTAGTACGCCTGTTAGGAGATTTATTCCAAGCAATTGAGGACCTGGATATTCAGCCTAGCGAGGTATGGAAGGGCTTAGAGTATTTCACAGATGCTGGTCAGGCAAACGAGTTAGGCTTGTTAGCCGCGGGTTTAGGCCTTGAACACTACTTGGATCTGCGTGCGGACGAGGCCGACGCTAAGGCGGGAGTGACGGGAGGGACTCCGCGCACGATTGAGGGACCATTATACGTAGCCGGGGCACCAGAGAGCGTGGGCTTCGCCCGTATGGATGATGGTACGGAGTCGGGAAAAATCGACACGCTGATTATCGAAGGAACCGTCACGGACACCGACGGCAATATTATTGAGAATGCTAAAGTAGAAGTCTGGCACGCTAATAGTCTTGGTAATTACTCCTTCTTCGATAAGTCTCAAAGTGATTTTAACTTACGTCGTACCATTCTGACGGACGCGGATGGGAAGTACGTCGCTCTGACGACAATGCCAGTAGGGTATGGGTGTCCTCCCGAGGGGACAACGCAGGCATTATTAAATAAATTGGGCCGTCATGGAAATCGCCCGAGTCACGTACACTACTTTGTCTCAGCACCGGGTTATCGTAAGCTGACGACACAATTTAATATCGAAGGTGATGAATATTTGTGGGATGATTTTGCCTTCGCAACCCGTGACGGGCTGGTCGCAACTGCGGTTGATGTTACCGATCCGGCGGAGATCCAGCGTCGCGGTTTAGACCACGCATTCAAACATATCACTTTTAACATTGAATTGGTTAAGGACGCAGCCGCGGCCCCCAGCACAGAGGTTGAACGTCGCCGTGCTTCAGCC
+
</partinfo>
+
  
 +
We tested the activity of CatA-FBD1 using cell extract of cells expressing our protein. <br>
 +
We tested our cell extract for CatA activity in Sodium Phosphate 50mM at pH 7, with 30mM of Catechol as substrate, as recommended in the literature. <br>
 +
Control corresponds to cells that do not express our proteins. In all cases, values measured correspond to reaction product. <br><br>
 +
https://static.igem.org/mediawiki/parts/d/d5/Paris_Bettencourt_notebook_catA1_goodforsure.jpg<br><br>
 +
 +
As the image indicates, there is a clear difference between our native and fusion enzymes and the control. We measured the reaction product at 260nm, which results from the oxidation of Catechol. Since much more reaction product is produced with cells expressing CatA than in the control, we can affirm that the enzyme was functional.<br>
 +
Binding the FBD1 decreased slightly the activity of CatA, but the enzyme was still functional.
 +
<br><br>
  
<!-- Uncomment this to enable Functional Parameter display
 
===Functional Parameters===
 
<partinfo>BBa_K2043002 parameters</partinfo>
 
 
<!-- -->
 
<!-- -->
 +
<span class='h3bb'>Sequence and Features</span>
 +
<partinfo>BBa_K2043011 SequenceAndFeatures</partinfo>
 +
  
<h1>catA-FBD1</h1>
+
Lin, J., & Milase, R. N. (2015). Purification and Characterization of Catechol 1, 2-Dioxygenase from Acinetobacter sp. Y64 Strain and Escherichia coli Transformants. The protein journal, 34(6), 421-433.<br><br>
  
<p>iGEM team Paris Bettencourt rules!! :)</p>
+
NCBI Reference Sequence: YP_004995593.1

Revision as of 19:24, 22 October 2016

catA-FBD1 from Acinetobacter pittii, codon optimized for E. coli

This part corresponds to Catechol-1,2-dioxygenase fused to the Fabric Binding Domain 1 (BBa_K2043010) cloned by the Paris Bettencourt team in 2016 in the context of the Frank&Stain project. This enzymes originally comes from Acinetobacter pittii, which we codon optimised for E. coli.
In order to facilitate working with this enzyme, we added a His-tag at the C-terminal. This tag allows for purification in an easier way.

The Fabric Binding Domain 1 (FBD1) has affinity for Cotton, Linnen, Polyester, Silk and Wool. It is positively charget (+1) and it is proline rich.

We chose to work with this enzyme because it seemed to be a good candidate for degrading Anthocyanins. Anthocyanins, the key pigments present in wine, are polyphenolic molecules that are naturally found in many plants. Our project consisted in the degradation of wine strains, and therefore enzymes with the ability to degrade polyphenolic molecules were of interest to us.
In particular, Catechol-dioxygenases are good candidates because they degrade Catechol, which is structurally similar to Anthocyanins.

Testing the part

We tested the activity of CatA-FBD1 using cell extract of cells expressing our protein.
We tested our cell extract for CatA activity in Sodium Phosphate 50mM at pH 7, with 30mM of Catechol as substrate, as recommended in the literature.
Control corresponds to cells that do not express our proteins. In all cases, values measured correspond to reaction product.

Paris_Bettencourt_notebook_catA1_goodforsure.jpg

As the image indicates, there is a clear difference between our native and fusion enzymes and the control. We measured the reaction product at 260nm, which results from the oxidation of Catechol. Since much more reaction product is produced with cells expressing CatA than in the control, we can affirm that the enzyme was functional.
Binding the FBD1 decreased slightly the activity of CatA, but the enzyme was still functional.

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]


Lin, J., & Milase, R. N. (2015). Purification and Characterization of Catechol 1, 2-Dioxygenase from Acinetobacter sp. Y64 Strain and Escherichia coli Transformants. The protein journal, 34(6), 421-433.

NCBI Reference Sequence: YP_004995593.1