Difference between revisions of "Part:BBa K2136016"

Line 96: Line 96:
 
<p align=justify>The samples purified from this method were used to further characterize our mCherry produced by Chlamydomonas reinhardtii. The Excitation/Emission spectrum (Figure 9) obtained are similar to the ones available to mCherry.</p>
 
<p align=justify>The samples purified from this method were used to further characterize our mCherry produced by Chlamydomonas reinhardtii. The Excitation/Emission spectrum (Figure 9) obtained are similar to the ones available to mCherry.</p>
 
<img src="https://static.igem.org/mediawiki/2016/0/09/T--USP_UNIFESP-Brazil--mCherry_spectra1.jpeg" width=800px><br>
 
<img src="https://static.igem.org/mediawiki/2016/0/09/T--USP_UNIFESP-Brazil--mCherry_spectra1.jpeg" width=800px><br>
Figure 9: Excitation/Emission spectrum of mCherry produced and purified from Chlamydomonas supernatant.  
+
Figure 9: Excitation/Emission spectrum of mCherry produced and purified from Chlamydomonas supernatant. <br><br>
  
 +
<p>[1] Improved monomeric red, orange and yellow fluorescent proteins derived from Discosomasp. red fluorescent protein.Nathan C Shaner, Robert E Campbell, Paul A Steinbach, Ben N G Giepmans, Amy E Palmer & Roger Y Tsien. Nature Biotechnology 22, 1567 - 1572 (2004) Published online: 21 November 2004 | doi:10.1038/nbt1037. http://www.nature.com/nbt/journal/v22/n12/full/nbt1037.html</p>
 +
<p>[2] Chlamydomonas reinhardtii: the model of choice to study mitochondria from unicellular photosynthetic organisms. Funes S1, Franzén LG, González-Halphen D. Methods Mol Biol. 2007;372:137-49. doi: 10.1007/978-1-59745-365-3_10. https://www.ncbi.nlm.nih.gov/pubmed/18314723</p>
 +
<p>[3] Computational genomics of photosynthetic organisms Julian Andres Mina Caicedo & Francisco J. Romero-Campero.</p>
 
</html>
 
</html>

Revision as of 16:23, 19 October 2016

Description

'''mCherry''' is a red fluorescent protein used as a reporter. It is based on a fluorescent protein that was originally isolated from ‘’Discosoma sp’’. and it’s being largely used due to its colour and photostability compared to other monomeric fluorophores. Another important property is that, with a system such as the one in [Part:BBa_K2136010]] secretion cells partially secrete mCherry. Therefore, it’s possible to monitor, in real-time, the kinetics of the process evaluated with aliquots of the cultivation medium or the biological material in study [1]. The ''' codon optimized mCherry for ''Chlamydomonas reinhardtii'' '''comes from the biobrick BBa_J06504 and it was improved to work specially with ''C. reinhardtii'', a microscopic algae used as model organism to study photosynthesis, cellular division, flagellar biogenesis, and, more recently, mitochondrial function [2]. Our team used this codon optimized mCherry to test the promoter activity and the expression capacity of the our new plasmid for microalgae transformation gBlock1 ([Part:BBa_K2136010]] ) .


Methods

Because not all tRNA are expressed equally, specially across species, a particular DNA sequence can be codon optimised to match the most prevalent tRNAs of the host cell, improving the efficiency of protein translation[REF]. So here are the changes that we made in the DNA sequence using the software GeneArt from Life Technologies:


Before Optimization After Optimization
ATGGTGAGCAAGGGCGAGGAGGATAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCTCCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGTGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCTCAGTTCATGTACGGCTCCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACTTGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCTTGCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCTCCGACGGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCTCCGAGCGGATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGAGGCTGAAGCTGAAGGACGGCGGCCACTACGACGCTGAGGTCAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTCAACATCAAGTTGGACATCACCTCCCACAACGAGGACTACACCATCGTGGAACAGTACGAACGCGCCGAGGGCCGCCACTCCACCGGCGGCATGGACGAGCTGTACAAGTAATAA ATGGTGTCCAAGGGCGAGGAGGACAACATGGCCATCATCAAGGAGTTCATGCGCTTCAAGGTGCACATGGAGGGCAGCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAGGGCGAGGGCCGCCCCTACGAGGGCACCCAGACCGCCAAGCTGAAGGTGACCAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGAGCCCCCAGTTCATGTACGGCAGCAAGGCCTACGTGAAGCACCCCGCCGACATCCCCGACTACCTGAAGCTGAGCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTTCGAGGACGGCGGCGTGGTGACCGTGACCCAGGACAGCAGCCTCCAGGACGGCGAGTTCATCTACAAGGTGAAGCTGCGCGGCACCAACTTCCCCAGCGACGGCCCCGTGATGCAGAAGAAGACCATGGGCTGGGAGGCCAGCAGCGAGCGCATGTACCCCGAGGACGGCGCCCTGAAGGGCGAGATCAAGCAGCGCCTGAAGCTGAAGGACGGCGGCCACTACGACGCCGAGGTGAAGACCACCTACAAGGCCAAGAAGCCCGTGCAGCTGCCCGGCGCCTACAACGTGAACATCAAGCTGGACATCACCAGCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGCGCGCTGAGGGCCGCCACAGCACCGGCGGCATGGACGAGCTGTACAAGTAA

After codon optimization, sequences had 94.51% of similarity (672/711 bp).



We successfully amplified the codon optimized mCherry, which has 711 bp, as can be seen in Figure 1.

Figure 1: Gel electrophoresis of mCherry+pSB1C3 construct


After ligating the sequence in the pJP22, we wanted to find the best way to transform C. reinhardtii, we tested Sapphire Blue, TAP medium and water as buffers during the electroporation. Then, cells were plated in Agar-TAP medium Petri dishes with different concentrations of Zeocin (an antibiotic from Bleomycin family) because the plasmid used had a sequence for Bleomycin resistance.


After 7 days we selected clones from previous dishes and started new cultures in a 96 well plate with 200 uL of TAP medium per well, agitation of 800 rpm, 25°C +- 1°C and 80 μE m−2 s−1 luminosity and a clear film sealing the plate. We also filled some wells with wild C. reinhardtii, just TAP medium or just mCherry as controls.



Figure 2: Cultivation setup for screening

For a better characterization of mCherry we’ve measured its excitation and emission spectra using a Tecan M200 Pro Microplate reader. In the 96 well plate we’ve measured the excitation and emission spectra of transformed C. reinhardtii supernatant, wild C. reinhardtii supernatant, water, TAP medium, transformed C. reinhardtii with spent TAP, wild C. reinhardtii with spent TAP, washed transformed C. reinhardtii with fresh TAP and washed wild C. reinhardtii with fresh TAP. For mCherry fluorescence detection we used excitation wavelength at 575 nm and emission at 608 nm, for inactive mCherry we used excitation wavelength at 410 nm and emission at 461, for Chlorophyll fluorescence we used 440 nm for excitation and 680 nm for emission. We also measured the absorbance at 750 nm for cellular concentration.


The TOP 5 mCherry-producer clones were E 10, which was transformed with TAP medium, and B1, B5, B6 and B11, which were transformed with Sapphire Blue as can be seen in Figure 3.


Figure 3: TOP 5 mCherry producers

Before purifying we wanted to see by our own eyes that mCherry was present in the solution. For that, we made the qualitative analysis schematized in Figure 4:


Figure 4: Experimental setup for qualitative detection of mCherry.

This special filter is able to block the laser light and at the same time allows the light emitted by mCherry to pass through it, as shown in Figure 5.


Figure 5: Spectra of experimental setup components

Our results are shown below in Figures 6.

Figure 6: Laser passing through cellular supernatant. A - Laser is passing through a wild type C. reinhardtii supernatant. B- Laser is passing through a transformed C. reinhardtii producing mCherry.


We used Fast Protein Liquid Chromatography (FPLC) to analyse and purify our mCherry. FPLC is an Ion exchange purification that exploit the net electrostatic charges of proteins, in pH values different of their pI (Isoelectric point). We developed a purification protocol to mCherry. First, we performed a gradient purification to establish the best salt concentration to elute mCherry.


Gradient Set Up:

Column: Resource Q (6 mL) - GE Healthcare
Buffer A: Sodium Phosphate 50 mM, pH7.5
Buffer B: Sodium Phosphate 50 mM, pH7.5 + 1M NaCl
Equilibration: 2 column volume (CV)
Injection: 0.5mL 40X Concentrate supernatant sample
Gradient length: 20 CV
Flow rate: 5mL/min
Fractionation: 5mL to unbound and 3 mL to the rest of the method

We obtained the following result (Figure 7).

Figure 7: Chromatogram of gradient mCherry purification. Green line (-) is the UV sensor reading. Red line (-) is buffer B percentage in the mixture. Black line (-) is the conductivity measurement. Blue line (-) is the fluorescence measurement of fractionated samples.

UV absorbance curve integration allow us to estimate the amount of protein separated from mCherry, 99% of all protein detected by the sensor was separated from mCherry fractions.


To further develop or method and reduce processing time, we developed a step based purification method (Figure 2). We kept 0% of B after injection for 3 CV, increase it a little bit to 0.7% of B to try to remove mCherry in this fraction, followed by a 100% of B step. This strategy was performed in a slower flow rate (3mL/min), and allow us to separate mCherry from 2 peaks in the beginning of the method. mCherry still left in the 0% step, but this method proved to be efficient, 99,7% of detected proteins were separated from mCherry.



Step based purification Set Up:


Column: Resource Q (6 mL) - GE Healthcare
Buffer A: Sodium Phosphate 50 mM, pH7.5
Buffer B: Sodium Phosphate 50 mM, pH7.5 + 1M NaCl
Equilibration: 2 column volume (CV)
Injection: 0.5mL 40X Concentrate supernatant sample
Step1: 3 CV
Step2: 2 CV
Step3: 5 CV
Flow rate: 3mL/min
Fractionation: 5mL to unbound and 1 mL to Step1, 3 mL to Step 2 and 5 mL to step 3.
We obtained the following result (Figure 8).
UPLOAD IMAGE
Figure 8: Chromatogram of step based mCherry purification. Green line (-) is the UV sensor reading. Red line (-) is buffer B percentage in the mixture. Black line (-) is the conductivity measurement. Blue line (-) is the fluorescence measurement of fractionated samples.

The samples purified from this method were used to further characterize our mCherry produced by Chlamydomonas reinhardtii. The Excitation/Emission spectrum (Figure 9) obtained are similar to the ones available to mCherry.


Figure 9: Excitation/Emission spectrum of mCherry produced and purified from Chlamydomonas supernatant.

[1] Improved monomeric red, orange and yellow fluorescent proteins derived from Discosomasp. red fluorescent protein.Nathan C Shaner, Robert E Campbell, Paul A Steinbach, Ben N G Giepmans, Amy E Palmer & Roger Y Tsien. Nature Biotechnology 22, 1567 - 1572 (2004) Published online: 21 November 2004 | doi:10.1038/nbt1037. http://www.nature.com/nbt/journal/v22/n12/full/nbt1037.html

[2] Chlamydomonas reinhardtii: the model of choice to study mitochondria from unicellular photosynthetic organisms. Funes S1, Franzén LG, González-Halphen D. Methods Mol Biol. 2007;372:137-49. doi: 10.1007/978-1-59745-365-3_10. https://www.ncbi.nlm.nih.gov/pubmed/18314723

[3] Computational genomics of photosynthetic organisms Julian Andres Mina Caicedo & Francisco J. Romero-Campero.