Difference between revisions of "Part:BBa K2075004:Design"

 
(Design Notes)
 
Line 7: Line 7:
  
 
===Design Notes===
 
===Design Notes===
No considerations.
+
This composite part includes an Intein and linker, the TAL-effector Ax7L-DS, a TEV Site and a Strep XT Tag. They are translated all together.
 
+
The intein and linker are important to circularice the aminoacid sequence between the N- and C-terminal parts. Between the Intein sites is the TAL-effector and the TEV Site. There is also a strep XT tag. When it is translated the intein sites react and form a circularised protein. All the parts between N- and C-Terminal Intein is part of the protein circle. In this circle the hole protein gains more stability. With the help of the strep XT tag the protein can be purified even if it is circularised. The Strep XT Tag is also usefull to detect the protein with an immunostain. The TEV Site give the opportunity to linearise the protein again wit the help oft he TEV protease. The linearised TALE can bind the specific DNA Sequence. The 12th and 13th amino acid of each of the repeats from our TAL effector Ax7L-DS are: NI NN HD NI HD NG NI NG NI NG NI NI NI HD HD HD HD HD They bind the DNA sequence: A G/A C A C T A T A T A A A C C C C C
 
+
  
 
===Source===
 
===Source===

Latest revision as of 19:05, 18 October 2016


Vector iGem_02_Ax7L- DS


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 3370
    Illegal BamHI site found at 2776
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal NgoMIV site found at 2715
    Illegal NgoMIV site found at 3310
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal SapI.rc site found at 2790


Design Notes

This composite part includes an Intein and linker, the TAL-effector Ax7L-DS, a TEV Site and a Strep XT Tag. They are translated all together. The intein and linker are important to circularice the aminoacid sequence between the N- and C-terminal parts. Between the Intein sites is the TAL-effector and the TEV Site. There is also a strep XT tag. When it is translated the intein sites react and form a circularised protein. All the parts between N- and C-Terminal Intein is part of the protein circle. In this circle the hole protein gains more stability. With the help of the strep XT tag the protein can be purified even if it is circularised. The Strep XT Tag is also usefull to detect the protein with an immunostain. The TEV Site give the opportunity to linearise the protein again wit the help oft he TEV protease. The linearised TALE can bind the specific DNA Sequence. The 12th and 13th amino acid of each of the repeats from our TAL effector Ax7L-DS are: NI NN HD NI HD NG NI NG NI NG NI NI NI HD HD HD HD HD They bind the DNA sequence: A G/A C A C T A T A T A A A C C C C C

Source

atgatcaaaatagccacacgtaaatatttaggcaaacaaaatgtctatgacattggagttgagcgcgaccataattttgcactcaaaaatggcttcatagcttccaactgtttcaatggcggttcgggcggttcgggcggcacaggcggttcgggcggttctatgtacccatacgatgttcctgactatgcggccaagaagaagaggaaggtgcaggtggatctacgcacgctcggctacagccagcagcaacaggagaagatcaaaccgaaggttcgttcgacagtggcgcagcaccacgaggcactggtcggccatgggtttacacacgcgcacatcgttgcgctcagccaacacccggcagcgttagggaccgtcgctgtcaagtatcaggacatgatcgcagcgttgccagaggcgacacacgaagcgatcgttggcgtcggcaaacagtggtccggcgcacgcgctctggaggccttgctcacggtggcgggagagttgagaggtccaccgttacagttggacacaggccaacttctcaagattgcaaagcgtggcggcgtgaccgcagtggaggcagtgcatgcatggcgcaatgcactgacgggtgcccccctgaaccttaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaataacggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagccacgatggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcgcatggccttaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagcaatggcggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagcaatattggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcgcatggccttaccccggagcaggtggtggccatcgccagcaatattggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgacaccggagcaggtggtggccatcgccagccacgatggtggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctcaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgactccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagacggtgcagcggctgttgccggtgctgtgccaggcccatggcctgaccccggagcaggtggtggccatcgccagccacgatggcggcaagcaggcgctggagagcattgttgcccagttatctcgccctgatccgtcgttggccgcgttaaccaacgaccacctcgtcgccttggcctgcctcggcggacgtcctgcgctggatgcagtgaaaaagggattgccgcacgcgccggccttgatcaaaagaaccaatcgccgtattcccgaacgcacatcccatcgcgttgccggatcccagctggtgaagagcgagctggaggagaagaagtccgagctgcggcacaagctgaagtacgtgccccacgagtacatcgagctgatcgagatcgccaggaaccccacccaggaccgcatcctggagatgaaggtgatggagttcttcatgaaggtgtacggctacaggggagagcacctgggcggaagcagaaagcctgacggcgccatctatacagtgggcagccccatcgattacggcgtgatcgtggacacaaaggcctacagcggcggctacaatctgcctatcggccaggccgacgcgatgcagagctacgtggaggagaaccagacccggaataagcacatcaaccccaacgagtggtggaaggtgtaccctagcagcgtgaccgagttcaagttcctgttcgtgagcggccacttcaagggcaactacaaggcccagctgaccaggctgaaccacatcaccaactgcaatggcgccgtgctgagcgtggaggagctgctgatcggcggcgagatgatcaaagccggcaccctgacactggaggaggtgcggcgcaagttcaacaacggcgagatcaacttcagatcttga

References