Difference between revisions of "Part:BBa K1937002:Design"

(Sequence:)
Line 1: Line 1:
 
=<b>Part: BBa_K1937002 (pSB1C3-OriKan)</b>=
 
=<b>Part: BBa_K1937002 (pSB1C3-OriKan)</b>=
<b>(Chassis <i>E. coli/B. subtilis</i>, carrier plasmid pSB1C3)
+
<b>(Chassis <i>E. coli/B. subtilis</i>, carrier plasmid pSB<sub>1</sub>C<sub>3</sub>)
 
Length: 2510 bp</b>
 
Length: 2510 bp</b>
  
 
<b>Background:</b>
 
<b>Background:</b>
While <i>Bacillus subtilis</i> is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they registered after sub-cloning in the <i>E. coli</i> plasmid pSB1C3. During the iGEM Toulouse 2016 project, we had the idea to create a part that could turn any pSB1C3-based plasmid in a shuttle vector (<i>E. coli/B. subtilis</i>).  
+
While <i>Bacillus subtilis</i> is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they registered after sub-cloning in the <i>E. coli</i> plasmid pSB<sub>1</sub>C<sub>3</sub>. During the iGEM Toulouse 2016 project, we had the idea to create a part that could turn any pSB1C3-based plasmid in a shuttle vector (<i>E. coli/B. subtilis</i>).  
 
This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France).
 
This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France).
  
Line 12: Line 12:
  
 
<b>Creation:</b>
 
<b>Creation:</b>
The BBa_K1937002 part contains the repU origin of replication of <i>B. subtilis</i> and the kanamycin resistance gene for <i>B. subtilis</i>. It was obtained by amplifying the repU-Kan region of pSBBsOK_P (BBa_K1351040 or BBa_K823026) using primers OriKan forward (5’ cacagaatcaggggataacgcaggaaagaaACATGTAGTTATAAGTGACTAAACAAATAACTAAATAGATGGG) and OriKan reverse (5’ gttcctggccttttgctggccttttgctcaACATGTCGCAAAATGGCCCGATTTAAG). The resulting fragment was sub-cloned in the pSB1C3 between the EcoRI and PstI restriction sites.
+
The BBa_K1937002 part contains the repU origin of replication of <i>B. subtilis</i> and the kanamycin resistance gene for <i>B. subtilis</i>. It was obtained by amplifying the repU-Kan region of pSB<sub>Bs</sub>0K-P (BBa_K1351040 or BBa_K823026) using primers OriKan forward (5’ cacagaatcaggggataacgcaggaaagaaACATGTAGTTATAAGTGACTAAACAAATAACTAAATAGATGGG) and OriKan reverse (5’ gttcctggccttttgctggccttttgctcaACATGTCGCAAAATGGCCCGATTTAAG). The resulting fragment was sub-cloned in the pSB<sub>1</sub>C<sub>3</sub> between the EcoRI and PstI restriction sites.
  
 
[[file:BBa_K1937002-map.jpg]]
 
[[file:BBa_K1937002-map.jpg]]
Line 19: Line 19:
 
   
 
   
 
<b>Validation:</b>
 
<b>Validation:</b>
We successfully transformed <i>E. coli</i> and selected clones on chloramphenicol. Likewise, we successfully transformed <i>B. subtilis</i> and selected clones on kanamycine. Presence of the pSB1C3-OriKan plasmid was demonstrated in <i>B. subtilis</i> by PCR checking. The part sequence has been verified by sequencing.  
+
We successfully transformed <i>E. coli</i> and selected clones on chloramphenicol. Likewise, we successfully transformed <i>B. subtilis</i> and selected clones on kanamycine. Presence of the pSB<sub>1</sub>C<sub>3</sub>-OriKan plasmid was demonstrated in <i>B. subtilis</i> by PCR checking. The part sequence has been verified by sequencing.  
  
 
More information available at http://2016.igem.org/Team:Toulouse_France/Description
 
More information available at http://2016.igem.org/Team:Toulouse_France/Description
Line 25: Line 25:
  
 
<b>Interest:</b>
 
<b>Interest:</b>
This part can be sub-cloned in any pSB1C3 plasmid to make it compatible with <i>B. subtilis</i>. It will therefore greatly simplified the use of <i>Bacillus subtilis</i> as a chassis and the registration of new <i>Bacillus</i>-aimed parts.
+
This part can be sub-cloned in any pSB<sub>1</sub>C<sub>3</sub> plasmid to make it compatible with <i>B. subtilis</i>. It will therefore greatly simplified the use of <i>Bacillus subtilis</i> as a chassis and the registration of new <i>Bacillus</i>-aimed parts.
  
  

Revision as of 17:33, 18 October 2016

Part: BBa_K1937002 (pSB1C3-OriKan)

(Chassis E. coli/B. subtilis, carrier plasmid pSB1C3) Length: 2510 bp

Background: While Bacillus subtilis is of huge interest for a growing number of iGEM projects, it is not easy to develop new parts as it is required that they registered after sub-cloning in the E. coli plasmid pSB1C3. During the iGEM Toulouse 2016 project, we had the idea to create a part that could turn any pSB1C3-based plasmid in a shuttle vector (E. coli/B. subtilis). This BioBrick is a part developed by the Toulouse 2016 iGEM team (http://2016.igem.org/Team:Toulouse_France).

More information available at http://2016.igem.org/Team:Toulouse_France/Description


Creation: The BBa_K1937002 part contains the repU origin of replication of B. subtilis and the kanamycin resistance gene for B. subtilis. It was obtained by amplifying the repU-Kan region of pSBBs0K-P (BBa_K1351040 or BBa_K823026) using primers OriKan forward (5’ cacagaatcaggggataacgcaggaaagaaACATGTAGTTATAAGTGACTAAACAAATAACTAAATAGATGGG) and OriKan reverse (5’ gttcctggccttttgctggccttttgctcaACATGTCGCAAAATGGCCCGATTTAAG). The resulting fragment was sub-cloned in the pSB1C3 between the EcoRI and PstI restriction sites.

BBa K1937002-map.jpg


Validation: We successfully transformed E. coli and selected clones on chloramphenicol. Likewise, we successfully transformed B. subtilis and selected clones on kanamycine. Presence of the pSB1C3-OriKan plasmid was demonstrated in B. subtilis by PCR checking. The part sequence has been verified by sequencing.

More information available at http://2016.igem.org/Team:Toulouse_France/Description


Interest: This part can be sub-cloned in any pSB1C3 plasmid to make it compatible with B. subtilis. It will therefore greatly simplified the use of Bacillus subtilis as a chassis and the registration of new Bacillus-aimed parts.



Sequence:

GTCTTCAAGAGTTCCTTAAGGAACGTACAGACGGCTTAAAAGCCTTTAAAAACGTTTTTAAGGGGTTTGTAGACAAGGTAAAGGATAAAACAGCACAATTCCAAGAAAAACACGATTTAGAACCTAAAAAGAACGAATTTGAACTAACTCATAACCGAGAGGTAAAAAAAGAACGAAGTCGAGATCAGGGAATGAGTTTATAAAATAAAAAAAGCACCTGAAAAGGTGTCTTTTTTTGATGGTTTTGAACTTGTTCTTTCTTATCTTGATACATATAGAAATAACGTCATTTTTATTTTAGTTGCTGAAAGGTGCGTTGAAGTGTTGGTATGTATGTGTTTTAAAGTATTGAAAACCCTTAAAATTGGTTGCACAGAAAAACCCCATCTGTTAAAGTTATAAGTGACTAAACAAATAACTAAATAGATGGGGGTTTCTTTTAATATTATGTGTCCTAATAGTAGCATTTATTCAGATGAAAAATCAAGGGTTTTAGTGGACAAGACAAAAAGTGGAAAAGTGAGACCATGGAGAGAAAAGAAAATCGCTAATGTTGATTACTTTGAACTTCTGCATATTCTTGAATTTAAAAAGGCTGAAAGAGTAAAAGATTGTGCTGAAATATTAGAGTATAAACAAAATCGTGAAACAGGCGAAAGAAAGTTGTATCGAGTGTGGTTTTGTAAATCCAGGCTTTGTCCAATGTGCAACTGGAGGAGAGCAATGAAACATGGCATTCAGTCACAAAAGGTTGTTGCTGAAGTTATTAAACAAAAGCCAACAGTTCGTTGGTTGTTTCTCACATTAACAGTTAAAAATGTTTATGATGGCGAAGAATTAAATAAGAGTTTGTCAGATATGGCTCAAGGATTTCGCCGAATGATGCAATATAAAAAAATTAATAAAAATCTTGTTGGTTTTATGCGTGCAACGGAAGTGACAATAAATAATAAAGATAATTCTTATAATCAGCACATGCATGTATTGGTATGTGTGGAACCAACTTATTTTAAGAATACAGAAAACTACGTGAATCAAAAACAATGGATTCAATTTTGGAAAAAGGCAATGAAATTAGACTATGATCCAAATGTAAAAGTTCAAATGATTCGACCGAAAAATAAATATAAATCGGATATACAATCGGCAATTGACGAAACTGCAAAATATCCTGTAAAGGATACGGATTTTATGACCGATGATGAAGAAAAGAATTTGAAACGTTTGTCTGATTTGGAGGAAGGTTTACACCGTAAAAGGTTAATCTCCTATGGTGGTTTGTTAAAAGAAATACATAAAAAATTAAACCTTGATGACACAGAAGAAGGCGATTTGATTCATACAGATGATGACGAAAAAGCCGATGAAGATGGATTTTCTATTATTGCAATGTGGAATTGGGAACGGAAAAATTATTTTATTAAAGAGTAGTTCAACAAACGGGCCAGTTTGTTGAAGATTAGATGCTATAATTGTTATTAAAAGGATTGAAGGATGCTTAGGAAGACGAGTTATTAATAGCTGAATAAGAACGGTGCTCTCCAAATATTCTTATTTAGAAAAGCAAATCTAAAATTATCTGAAAAGGGAATGAGAATAGTGAATGGACCAATAATAATGACTAGAGAAGAAAGAATGAAGATTGTTCATGAAATTAAGGAACGAATATTGGATAAATATGGGGATGATGTTAAGGCTATTGGTGTTTATGGCTCTCTTGGTCGTCAGACTGATGGGCCCTATTCGGATATTGAGATGATGTGTGTCATGTCAACAGAGGAAGCAGAGTTCAGCCATGAATGGACAACCGGTGAGTGGAAGGTGGAAGTGAATTTTGATAGCGAAGAGATTCTACTAGATTATGCATCTCAGGTGGAATCAGATTGGCCGCTTACACATGGTCAATTTTTCTCTATTTTGCCGATTTATGATTCAGGTGGATACTTAGAGAAAGTGTATCAAACTGCTAAATCGGTAGAAGCCCAAACGTTCCACGATGCGATTTGTGCCCTTATCGTAGAAGAGCTGTTTGAATATGCAGGCAAATGGCGTAATATTCGTGTGCAAGGACCGACAACATTTCTACCATCCTTGACTGTACAGGTAGCAATGGCAGGTGCCATGTTGATTGGTCTGCATCATCGCATCTGTTATACGACGAGCGCTTCGGTCTTAACTGAAGCAGTTAAGCAATCAGATCTTCCTTCAGGTTATGACCATCTGTGCCAGTTCGTAATGTCTGGTCAACTTTCCGACTCTGAGAAACTTCTGGAATCGCTAGAGAATTTCTGGAATGGGATTCAGGAGTGGACAGAACGACACGGATATATAGTGGATGTGTCAAAACGCATACCATTTTGAACGATGACCTCTAATAATTGTTAATCATGTTGGTTACGTATTTATTAACTTCTCCTAGTATTAGTAATTATCATGGCTGTCATGGCGCATTAACGGAATAAAGGGTGTGCTTAAATCGGGCCATTTTG

Annotation:
repU : 431-1435
Kan : 1595-2365