Difference between revisions of "Part:BBa K1928003"

 
 
Line 3: Line 3:
 
<partinfo>BBa_K1928003 short</partinfo>
 
<partinfo>BBa_K1928003 short</partinfo>
  
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(CTAGTTGGGCGAGTTACGGACCTCTAAACC), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b.
+
Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(TTTGCATTGTGGTTGGCGGCGGGTGTCCTG), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b.
  
  

Latest revision as of 10:38, 18 October 2016


toehold switch sensor to detect HCV 1b RNA

Toehold switch is a secondary structure of RNA. Because of special sequence design, it can form a hairpin structure and hide ribosome binding site (RBS)in the loop. There are three basic elements of toehold switches including 30bp toehold sequence(TTTGCATTGTGGTTGGCGGCGGGTGTCCTG), bacteria ribosome binding site and linker.The trigger sequence of this part is complementary to a part of HCV 1b RNA. The hairpin is unwounded upon binding of HCV RNA. Therefore, when HCV RNA is present, the ribosome is able to bind on the RBS and translate the down stream gene. Insert the sequence before a reporter gene to realize sequence-specific detection of HCV 1b.


Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    COMPATIBLE WITH RFC[21]
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    COMPATIBLE WITH RFC[1000]