Difference between revisions of "Part:BBa K1926002"

(→‎Usage)
Line 1: Line 1:
 
<partinfo>BBa_K1926002 short</partinfo>
 
<partinfo>BBa_K1926002 short</partinfo>
  
−
This part is a cyclic promoter of Ki67 from human genome. It can lead to transcription of the downstream DNA sequence once in every G1 phase[1].
+
===Fuction and Biology===
  
 +
Ki-67 is a cell proliferation marker which is tightly associated with cell division[1]. In detail, except for G0 phase, the Ki-67 protein is present in all phases of the cell cycle ( including G1, S, G2 and M)[1]. Owing to the fact that Ki-67 gene only transcribe once in every cell cycle, the Ki-67 promoter must lead to transcription of the downstream DNA sequence once in every G1 phase.
 +
 +
According to Pei, D.S., et al., whom first cloned the 5’-flanking region of the human Ki-67 gene and located the Ki-67 core promoter, the Ki-67 promoter is the TATA-less, GC-rich region comprised of
 +
several putative Sp1 binding sites, one human zinc finger 5 protein (ZF5) consensus element, and one cell-cycle gene homology region (CHR)[1].
 +
 +
As for the function of Ki-67 promoter, it has been proved that it had higher transcription activity compared with the hTERT promoter and Survivin promoter[1].
 +
 +
For its regulation, it has been proved that the binding side of transcription factor Sp1, a ubiquitous transcription factor, existed in the Ki-67 core promoter. Besides, this promoter was proved to be repressed by interferon regulatory factor 1 (IRF1) in human Ketr-3 and 786-O renal carcinoma cells [2] and inhibited by p53 via p53- and Sp1-dependent pathway [3].
  
 
<!-- -->
 
<!-- -->
Line 17: Line 25:
 
2) Use it as a human promoter by transient transfecting it into cells.
 
2) Use it as a human promoter by transient transfecting it into cells.
  
−
===Source===
+
 
 +
===Design Notes===
  
 
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
 
The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:
Line 38: Line 47:
 
===Reference===
 
===Reference===
 
1. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66.
 
1. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66.
 +
2. Chen, F., et al., IRF1 suppresses Ki-67 promoter activity through interfering with Sp1 activation. Tumor Biology, 2012. 33(6): p. 2217-2225.
 +
3. Wang, M.-J., et al., p53 regulates Ki-67 promoter activity through p53- and Sp1-dependent manner in HeLa cells. Tumor Biology, 2011. 32(5): p. 905.
 +
  
  

Revision as of 03:30, 18 October 2016

A cyclic promoter of Ki-67 from human genome

Fuction and Biology

Ki-67 is a cell proliferation marker which is tightly associated with cell division[1]. In detail, except for G0 phase, the Ki-67 protein is present in all phases of the cell cycle ( including G1, S, G2 and M)[1]. Owing to the fact that Ki-67 gene only transcribe once in every cell cycle, the Ki-67 promoter must lead to transcription of the downstream DNA sequence once in every G1 phase.

According to Pei, D.S., et al., whom first cloned the 5’-flanking region of the human Ki-67 gene and located the Ki-67 core promoter, the Ki-67 promoter is the TATA-less, GC-rich region comprised of several putative Sp1 binding sites, one human zinc finger 5 protein (ZF5) consensus element, and one cell-cycle gene homology region (CHR)[1].

As for the function of Ki-67 promoter, it has been proved that it had higher transcription activity compared with the hTERT promoter and Survivin promoter[1].

For its regulation, it has been proved that the binding side of transcription factor Sp1, a ubiquitous transcription factor, existed in the Ki-67 core promoter. Besides, this promoter was proved to be repressed by interferon regulatory factor 1 (IRF1) in human Ketr-3 and 786-O renal carcinoma cells [2] and inhibited by p53 via p53- and Sp1-dependent pathway [3].

Sequence and Features


Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal XhoI site found at 425
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    COMPATIBLE WITH RFC[25]
  • 1000
    INCOMPATIBLE WITH RFC[1000]
    Illegal BsaI site found at 422


Usage

You may use this part to:

1) Express something in mammal cell lines particularly in G1 phases or once in every cell cycle by stable transfecting it into cell line;

2) Use it as a human promoter by transient transfecting it into cells.


Design Notes

The sequence was retrieved from Addgene. We got it from human genome through PCR using the following primers:

pKi67-F: ACCTCTGCCCTCCGCCAGCCG

pKi67-R: ACCCGGTGGCCCTACAGGCTACG

(Product: 360)


Promoter function confirmation

G1 promoter function confirmation by transient transfection using 293T cells. Photos taken 48 hours after transient transfection, 10x. pCDK4, pKi67 and pCCNE are our G1 promoters. pmPGK is the constitutive promoter of mouse PGK, it is a medium promoter, here used as a control.

Figure 1: in vivo testing pG1 promoter function in human 293 cell line.



Reference

1. Pei, D.S., et al., Analysis of human Ki-67 gene promoter and identification of the Sp1 binding sites for Ki-67 transcription. Tumour Biol, 2012. 33(1): p. 257-66. 2. Chen, F., et al., IRF1 suppresses Ki-67 promoter activity through interfering with Sp1 activation. Tumor Biology, 2012. 33(6): p. 2217-2225. 3. Wang, M.-J., et al., p53 regulates Ki-67 promoter activity through p53- and Sp1-dependent manner in HeLa cells. Tumor Biology, 2011. 32(5): p. 905.